CRISPR-Cas9

gRNA Database

About Page

In the top right search box on any page, enter in a Gene Symbol (e.g. GAPDH), NCBI refSeq ID (e.g. NM_002046), grID (e.g. hs025713228), or 23-bp targeting sequence (e.g. GCATCTTCTTTTGCGTCGCCAGG).

grID Database

The grID database is also designed to keep up with the rapidly evolving CRISPR technology. Here, numerous Cas9 targeting sites for orthologous or evolved Cas9 proteins, and altenative CRISPR systems, such as Cpf1. To view the extensive sequences contained in the grID database, see Database properties.

Advanced Search

The Advanced searches allows users to perform highly customizable filters for identifying CRISPR targets whithin specific regions of genes, or for use of alternative Cas9 proteins.


Resources


Oligo Generator

Use this form to quickly generate specific oligos for cloning gRNA targets into a variety of expression vectors.

gRNA Cloning Protocols

Optimized protocols for cloning gRNAs into common expression plasmids.

Transfection Protocols

General transfection protocol for CRISPR in human or mouse cell lines.

Calculations

Calculations for NHEJ and HDR efficiencies.


Preprint available on bioRxiv



Human Genome Browser

Visualize gRNAs on the genome.


Mouse Genome Browser

Visualize gRNAs on the genome.


CRISPR Assays

Surveyor/T7 Endo I Assay

Common assays for quantifying CRISPR experiments.

Restriction Digest Assay

Alternate assay for quantifying CRISPR experiments.