General Information

About

CRISPR-Cas9 genome-editing is a revolutionary technology that is transforming biological research. The explosive growth and advances in CRISPR research over the last few years, coupled with the potential for clinical applications and therapeutics, is heralding a new era for genome engineering.

To support this technology platform and to provide a universal CRISPR annotation system, we introduce grID: a CRISPR-Cas9 gRNA database. This site provides an extensive compilation of gRNA properties including sequence and variations, thermodynamic parameters, off-target analyses, and alternative PAM sites, among others.

To aid in the design of optimal gRNAs, the website is integrated with other prominent databases, providing a wealth of additional resources to guide users from in silico analysis through experimental CRISPR targeting. All the tools, protocols, plasmids, and resources that are needed for successful CRISPR-based genome targeting are provided.

Usage

In the top right search box on any page, enter in a Gene Symbol (e.g. GAPDH), NCBI refSeq ID (e.g. NM_002046), grID (e.g. hs025713228), or 23-bp targeting sequence (e.g. GCATCTTCTTTTGCGTCGCCAGG).

grID System



Responsive image


The grID (gRNA Identification) system systematically identifies CRISPR-Cas9 targeting sites in the genome. For example, the targeting site for the commonly used S. pyogenes Cas9 is N20NGG. In the human genome, there are 137,409,562 sites that fit this criteria. Each site is identified by a two-letter genome code and a number that uniquely identifies the genomic location of this sequence. For the human target database the grIDs number from hs000000001 to hs137409562.


The database also stores the CRISPR-Cas9 targeting sites for alternative Cas9 proteins.

Organism Genome Build Target Site Cas9 Occurrences grID prefix grID suffix
human hg19 N20NGG S. pyogenes (Spy) 137,409,562 hs
human hg19 N23GRRT S. aureus (Sa) 37,210,017 hs [sa]
human hg19 N18NNAGAAW S. thermophilus (St) 14,075,478 hs [st]
human hg19 N24NNNNGATT N. meningitidis (Nm) 10,219,504 hs [nm]

Mouse Genome

Organism Genome Build Target Site Cas9 Occurrences grID prefix grID suffix
mouse mm10 N20NGG S. pyogenes (Spy) 139,219,730 mm
mouse mm10 N23GRRT S. aureus (Sa) 38,584,448 mm [sa]
mouse mm10 N18NNAGAAW S. thermophilus (St) 13,517,569 mm [st]
mouse mm10 N24NNNNGATT N. meningitidis (Nm) 9,976,717 mm [nm]

S. pyogenes Cas9 sites for other genomes.

Organism Genome Build Target Site Cas9 Occurrences grID prefix
human hg19 N20NGG S. pyogenes (Spy) 137,409,562 hs
human hg19 N20NAG S. pyogenes (Spy) 188,430,119 hs
mouse mm10 N20NGG S. pyogenes (Spy) 139,219,730 mm
rat rn5 N20NGG S. pyogenes (Spy) 143,165,607 rn
zebrafish danRer7 N20NGG S. pyogenes (Spy) 40,351,770 dr
C. elegans ce10 N20NGG S. pyogenes (Spy) 5,645,205 ce
S. cerevisiae sacCer3 N20NGG S. pyogenes (Spy) 944,171 sc

Alternative CRISPR systems (CRISPR-Cpf1)

Organism Genome Build Target Site CRISPR System Occurrences grID prefix
human hg19 TTTNN23 AsCpf1 or LbCpf1 99,828,092 hs
Responsive image


The grID system provides an unambiguous method to refer to CRISPR targeting sites similar to gene IDs or reference SNP numbers. Secondly, various properties are calculated for each site including the gRNA genomic location, sequence and thermodynamic properties, and potential off-target sites. Because we have databased the off-target potential for every CRISPR target sequence, the query response time is virtually instantaneous.

Responsive image

grID Score

The grID Score is determined through iterative 5' truncations and genomic alignments. This process identifies "more unique" CRISPR targeting sites in the genome with a bias towards the "seed", or the high-affinity PAM proximal region.



Responsive image

Genome Browser

For users who prefer data visualization through a genome browser, grID data can be viewed through a full-page JBrowse Genome Browser, or via the UCSC Genome Browser. Both options allow users to interact with their own data.

Advanced Search

The Advanced search page allows users to target a specific mutation within a gene. Using a refSeq ID and a codon location (e.g. NM_002046 and amino acid position 10). The program determines the corresponding codon and genomic location(s) (which could reside on multiple exons) and provides an output of potential gRNA targets.

An Oligo form is available to generate primers for cloning any gRNA in the database (or other N20NGG sequence) into various expression vectors. Construct generation for the user is simplified though the use of a common restriction enzyme (AvrII), cloning method (Gibson Assembly), antibiotic selection marker (ampicillin), and sequencing primers (M13R). Though our Resource page users have access to extensively detailed protocols that we have tested and optimized for generating specific CRISPR targeting constructs.

Protocols, Resources, and More...

gRNA selection is only one step in the process of genome editing. Since an important aspect of the grID database/website is to create an encompassing CRISPR ecosystem available through a single centralized location and to facilitate CRISPR research by bridging in silico analysis with laboratory resources, we have also strived to provide other resources to help potential users.

We provide detailed protocols for generating specific CRISPR targeting constructs. These protocols have been tested and optimized. Additionally, we have made all plasmids that are required for CRISPR targeting, freely available through Addgene.

CRISPR Community

In an effort to promote scientific collaboration and to disseminate valuable information to the CRISPR community, we encourage use of the comments section provided at the bottom of any grID or gene page. Any relevant information that is provided will only be visible on that specific page.

Users also have access to a public Google Discussion Forum for all-things-CRISPR

Comments