grID Information

Summary

grID: hs025713212
Sequence (23-mer): CTCGGACCCCGCCTCCCGCCAGG
grID Score: moderate (500)
Doench (2014) Score: 0.10988
Doench (2016) Score: 0.39355
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643624-6643602
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537806
NM_014865 NCAPD2chr12660329766411322492
NM_001039670 IFFO1chr12664869366652495091
NM_001193457 IFFO1chr12664869366652495091

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): CUCGGACCCCGCCUCCCGCC
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 85
GC-score: high
Tm (°C): 65.80
Tm score: moderate
RNAfold (dot bracket): ..(((..........)))..
deltaG (Kcal/mol): -2.10
Predicted Folding: low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 6
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 5
1chr12:6643601-66436240
CCTGGCGGGAGGCGGGGTCCGAG
|||||||||||||||||||||||
CCTGGCGGGAGGCGGGGTCCGAG
2chr19:14017424-140174473
CTCGGACCCCGCCTCCCGCCAGG
|*|||*|||||||||||*|||||
CCCGGTCCCCGCCTCCCCCCAGG
3chr1:202407552-2024075753
CTCGGACCCCGCCTCCCGCCAGG
|||*|*||||||||||*||||||
CTCTGCCCCCGCCTCCTGCCAGG
4chr15:90455976-904559993
CCTGGCGGGAGGCGGGGTCCGAG
|||||*|||*||||||||||*||
CCTGGGGGGTGGCGGGGTCCCAG
5chr9:99145928-991459513
CTCGGACCCCGCCTCCCGCCAGG
|*|||||||||||*||||||||*
CGCGGACCCCGCCGCCCGCCAGC
6chr19:34895510-348955333
CCTGGCGGGAGGCGGGGTCCGAG
|||||*|||||*|||||||*|||
CCTGGGGGGAGCCGGGGTCGGAG
1
Number of Mismatches:0
Location:chr12:6643601-6643624
Genomic Sequence:CTCGGACCCCGCCTCCCGCCAGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:CTCGGACCCCGCCTCCCGCCAGG
Alignment:
CTCGGACCCCGCCTCCCGCCAGG
|||||||||||||||||||||||
CTCGGACCCCGCCTCCCGCCAGG
Mismatch:
2
Number of Mismatches:3
Location:chr19:14017424-14017447
Genomic Sequence:CCCGGTCCCCGCCTCCCCCCAGG
Strand:+
Genomic Region:gene(CC2D1A)
3' PAM Orientation:CCCGGTCCCCGCCTCCCCCCAGG
Alignment:
CTCGGACCCCGCCTCCCGCCAGG
|*|||*|||||||||||*|||||
CCCGGTCCCCGCCTCCCCCCAGG
Mismatch:
.C.....................
.....T.................
.................C.....
Distal mismatch
Distal mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr1:202407552-202407575
Genomic Sequence:CTCTGCCCCCGCCTCCTGCCAGG
Strand:+
Genomic Region:gene(PPP1R12B)
3' PAM Orientation:CTCTGCCCCCGCCTCCTGCCAGG
Alignment:
CTCGGACCCCGCCTCCCGCCAGG
|||*|*||||||||||*||||||
CTCTGCCCCCGCCTCCTGCCAGG
Mismatch:
...T...................
.....C.................
................T......
Distal mismatch
Distal mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr15:90455976-90455999
Genomic Sequence:CTGGGACCCCGCCACCCCCCAGG
Strand:-
Genomic Region:exon(NM_001199058.exon0)
3' PAM Orientation:CTGGGACCCCGCCACCCCCCAGG
Alignment:
CTCGGACCCCGCCTCCCGCCAGG
||*||||||||||*|||*|||||
CTGGGACCCCGCCACCCCCCAGG
Mismatch:
..G....................
.............A.........
.................C.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr9:99145928-99145951
Genomic Sequence:CGCGGACCCCGCCGCCCGCCAGC
Strand:+
Genomic Region:exon(NM_007001.exon0)
3' PAM Orientation:CGCGGACCCCGCCGCCCGCCAGC
Alignment:
CTCGGACCCCGCCTCCCGCCAGG
|*|||||||||||*||||||||*
CGCGGACCCCGCCGCCCGCCAGC
Mismatch:
.G.....................
.............G.........
......................C
Distal mismatch
Proximal seed mismatch
PAM mismatch
6
Number of Mismatches:3
Location:chr19:34895510-34895533
Genomic Sequence:CTCCGACCCCGGCTCCCCCCAGG
Strand:-
Genomic Region:gene(PDCD2L)
3' PAM Orientation:CTCCGACCCCGGCTCCCCCCAGG
Alignment:
CTCGGACCCCGCCTCCCGCCAGG
|||*|||||||*|||||*|||||
CTCCGACCCCGGCTCCCCCCAGG
Mismatch:
...C...................
...........G...........
.................C.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713213337
hs02571322890124
hs02571323199133
hs025713232100134

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
RflFIIICGCCAGCGCCAGCTCGGACCCCGCCTCCCGCCAGG
AvaIIGGWCCGGACCCTCGGACCCCGCCTCCCGCCAGG
PsuGIBBCGDCTCGGCTCGGACCCCGCCTCCCGCCAGG
ScrFICCNGGCCAGGCTCGGACCCCGCCTCCCGCCAGG
RlaIVCWCCTCTCGGACCCCGCCTCCCGCCAGG
RlaIVCWCCACTCGGACCCCGCCTCCCGCCAGG
Hpy188ITCNGATCGGACTCGGACCCCGCCTCCCGCCAGG
EcoRIICCWGGCCAGGCTCGGACCCCGCCTCCCGCCAGG
NlaIVGGNNCCGGACCCCTCGGACCCCGCCTCCCGCCAGG
AciICCGCCCGCCTCGGACCCCGCCTCCCGCCAGG
AciICCGCCCGCCTCGGACCCCGCCTCCCGCCAGG

SNPs and Variation

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments