grID Information

Summary

grID: hs025713215
Sequence (23-mer): ACCGGGGGCGCGGCGGCAGGCGG
grID Score: moderate (600)
Doench (2014) Score: 0.04552
Doench (2016) Score: 0.51494
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643650-6643628
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537780
NM_014865 NCAPD2chr12660329766411322518
NM_001039670 IFFO1chr12664869366652495065
NM_001193457 IFFO1chr12664869366652495065

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): ACCGGGGGCGCGGCGGCAGG
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 90
GC-score: very high
Tm (°C): 72.94
Tm score: high
RNAfold (dot bracket): .(((......))).......
deltaG (Kcal/mol): -4.00
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 13
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches: 1
Total Genomic Sites With 3 Mismatches: 11
1chr12:6643627-66436500
CCGCCTGCCGCCGCGCCCCCGGT
|||||||||||||||||||||||
CCGCCTGCCGCCGCGCCCCCGGT
2chr17:18022467-180224902
CCGCCTGCCGCCGCGCCCCCGGT
||||||||*|||||||*||||||
CCGCCTGCGGCCGCGCGCCCGGT
3chr1:227058659-2270586823
CCGCCTGCCGCCGCGCCCCCGGT
|||||||||||||*|||||*|*|
CCGCCTGCCGCCGGGCCCCGGCT
4chr1:2136024-21360473
CCGCCTGCCGCCGCGCCCCCGGT
|||||*|||||||*||||||||*
CCGCCAGCCGCCGGGCCCCCGGA
5chr22:38142288-381423113
ACCGGGGGCGCGGCGGCAGGCGG
*||||*|||||||||||*|||||
GCCGGAGGCGCGGCGGCGGGCGG
6chr7:36406644-364066673
ACCGGGGGCGCGGCGGCAGGCGG
**||||||||||||||*||||||
GGCGGGGGCGCGGCGGGAGGCGG
7chr8:130951953-1309519763
ACCGGGGGCGCGGCGGCAGGCGG
|*||||||*||||||||||*|||
AGCGGGGGAGCGGCGGCAGCCGG
8chr9:94186010-941860333
ACCGGGGGCGCGGCGGCAGGCGG
*||||||*||||||||*||||||
TCCGGGGCCGCGGCGGGAGGCGG
9chr14:97263828-972638513
ACCGGGGGCGCGGCGGCAGGCGG
*||||||||||||*|||*|||||
GCCGGGGGCGCGGAGGCGGGCGG
10chr16:639640-6396633
ACCGGGGGCGCGGCGGCAGGCGG
*|||||||||*||||||*|||||
GCCGGGGGCGGGGCGGCCGGCGG
11chr6:108489648-1084896713
CCGCCTGCCGCCGCGCCCCCGGT
||||||||*||*|||||||||*|
CCGCCTGCGGCGGCGCCCCCGCT
12chr1:225965357-2259653803
ACCGGGGGCGCGGCGGCAGGCGG
|||||||||||*|*|||||*|||
ACCGGGGGCGCTGTGGCAGCCGG
13chr15:85259033-852590563
CCGCCTGCCGCCGCGCCCCCGGT
||||*|*|||||*||||||||||
CCGCGTCCCGCCCCGCCCCCGGT
1
Number of Mismatches:0
Location:chr12:6643627-6643650
Genomic Sequence:ACCGGGGGCGCGGCGGCAGGCGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:ACCGGGGGCGCGGCGGCAGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
|||||||||||||||||||||||
ACCGGGGGCGCGGCGGCAGGCGG
Mismatch:
2
Number of Mismatches:2
Location:chr17:18022467-18022490
Genomic Sequence:ACCGGGCGCGCGGCCGCAGGCGG
Strand:-
Genomic Region:exon(NM_016239.exon1)
3' PAM Orientation:ACCGGGCGCGCGGCCGCAGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
||||||*|||||||*||||||||
ACCGGGCGCGCGGCCGCAGGCGG
Mismatch:
......C................
..............C........
Distal mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr1:227058659-227058682
Genomic Sequence:AGCCGGGGCCCGGCGGCAGGCGG
Strand:-
Genomic Region:gene(PSEN2)
3' PAM Orientation:AGCCGGGGCCCGGCGGCAGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
|*|*|||||*|||||||||||||
AGCCGGGGCCCGGCGGCAGGCGG
Mismatch:
.G.....................
...C...................
.........C.............
Distal mismatch
Distal mismatch
Distal seed mismatch
4
Number of Mismatches:3
Location:chr1:2136024-2136047
Genomic Sequence:TCCGGGGGCCCGGCGGCTGGCGG
Strand:-
Genomic Region:gene(C1orf86)
3' PAM Orientation:TCCGGGGGCCCGGCGGCTGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
*||||||||*|||||||*|||||
TCCGGGGGCCCGGCGGCTGGCGG
Mismatch:
T......................
.........C.............
.................T.....
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr22:38142288-38142311
Genomic Sequence:GCCGGAGGCGCGGCGGCGGGCGG
Strand:+
Genomic Region:exon(NM_007032.exon0)
3' PAM Orientation:GCCGGAGGCGCGGCGGCGGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
*||||*|||||||||||*|||||
GCCGGAGGCGCGGCGGCGGGCGG
Mismatch:
G......................
.....A.................
.................G.....
Distal mismatch
Distal mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr7:36406644-36406667
Genomic Sequence:GGCGGGGGCGCGGCGGGAGGCGG
Strand:+
Genomic Region:exon(NM_001199707.exon0)
3' PAM Orientation:GGCGGGGGCGCGGCGGGAGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
**||||||||||||||*||||||
GGCGGGGGCGCGGCGGGAGGCGG
Mismatch:
G......................
.G.....................
................G......
Distal mismatch
Distal mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr8:130951953-130951976
Genomic Sequence:AGCGGGGGAGCGGCGGCAGCCGG
Strand:+
Genomic Region:exon(NR_046359.exon0)
3' PAM Orientation:AGCGGGGGAGCGGCGGCAGCCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
|*||||||*||||||||||*|||
AGCGGGGGAGCGGCGGCAGCCGG
Mismatch:
.G.....................
........A..............
...................C...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr9:94186010-94186033
Genomic Sequence:TCCGGGGCCGCGGCGGGAGGCGG
Strand:+
Genomic Region:exon(NM_005384.exon0)
3' PAM Orientation:TCCGGGGCCGCGGCGGGAGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
*||||||*||||||||*||||||
TCCGGGGCCGCGGCGGGAGGCGG
Mismatch:
T......................
.......C...............
................G......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr14:97263828-97263851
Genomic Sequence:GCCGGGGGCGCGGAGGCGGGCGG
Strand:+
Genomic Region:gene(VRK1)
3' PAM Orientation:GCCGGGGGCGCGGAGGCGGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
*||||||||||||*|||*|||||
GCCGGGGGCGCGGAGGCGGGCGG
Mismatch:
G......................
.............A.........
.................G.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr16:639640-639663
Genomic Sequence:GCCGGGGGCGGGGCGGCCGGCGG
Strand:+
Genomic Region:gene(RAB40C)
3' PAM Orientation:GCCGGGGGCGGGGCGGCCGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
*|||||||||*||||||*|||||
GCCGGGGGCGGGGCGGCCGGCGG
Mismatch:
G......................
..........G............
.................C.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr6:108489648-108489671
Genomic Sequence:AGCGGGGGCGCCGCCGCAGGCGG
Strand:-
Genomic Region:gene(NR2E1)
3' PAM Orientation:AGCGGGGGCGCCGCCGCAGGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
|*|||||||||*||*||||||||
AGCGGGGGCGCCGCCGCAGGCGG
Mismatch:
.G.....................
...........C...........
..............C........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chr1:225965357-225965380
Genomic Sequence:ACCGGGGGCGCTGTGGCAGCCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:ACCGGGGGCGCTGTGGCAGCCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
|||||||||||*|*|||||*|||
ACCGGGGGCGCTGTGGCAGCCGG
Mismatch:
...........T...........
.............T.........
...................C...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
13
Number of Mismatches:3
Location:chr15:85259033-85259056
Genomic Sequence:ACCGGGGGCGGGGCGGGACGCGG
Strand:-
Genomic Region:gene(SEC11A)
3' PAM Orientation:ACCGGGGGCGGGGCGGGACGCGG
Alignment:
ACCGGGGGCGCGGCGGCAGGCGG
||||||||||*|||||*|*||||
ACCGGGGGCGGGGCGGGACGCGG
Mismatch:
..........G............
................G......
..................C....
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132286498
hs02571323173107
hs02571323274108
hs02571323377111
hs02571323589123
hs02571323690124
hs02571323793127
hs02571323898132
hs02571323999133

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
BisIGCNGCGCGGCACCGGGGGCGCGGCGGCAGGCGG
HhaIGCGCGCGCACCGGGGGCGCGGCGGCAGGCGG
SecICCNNGGCCGGGGACCGGGGGCGCGGCGGCAGGCGG
PsuGIBBCGDCGCGGACCGGGGGCGCGGCGGCAGGCGG
PsuGIBBCGDGGCGGACCGGGGGCGCGGCGGCAGGCGG
RlaIVCWGCAACCGGGGGCGCGGCGGCAGGCGG
FnuDIICGCGCGCGACCGGGGGCGCGGCGGCAGGCGG
CauIICCSGGCCGGGACCGGGGGCGCGGCGGCAGGCGG
HpaIICCGGCCGGACCGGGGGCGCGGCGGCAGGCGG
Cac8IGCNNGCGCAGGCACCGGGGGCGCGGCGGCAGGCGG
TauIGCSGCGCGGCACCGGGGGCGCGGCGGCAGGCGG
GlaIGCGCGCGCACCGGGGGCGCGGCGGCAGGCGG
ScrFICCNGGCCGGGACCGGGGGCGCGGCGGCAGGCGG
Fnu4HIGCNGCGCGGCACCGGGGGCGCGGCGGCAGGCGG

SNPs and Variation

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments