grID Information

Summary

grID: hs025713216
Sequence (23-mer): GAAACCGGGGGCGCGGCGGCAGG
grID Score: moderate (500)
Doench (2014) Score: 0.00330
Doench (2016) Score: 0.39706
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643653-6643631
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537777
NM_014865 NCAPD2chr12660329766411322521
NM_001039670 IFFO1chr12664869366652495062
NM_001193457 IFFO1chr12664869366652495062

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GAAACCGGGGGCGCGGCGGC
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 85
GC-score: high
Tm (°C): 71.37
Tm score: high
RNAfold (dot bracket): ....(((......)))....
deltaG (Kcal/mol): -4.00
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 3
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 2
1chr12:6643630-66436530
CCTGCCGCCGCGCCCCCGGTTTC
|||||||||||||||||||||||
CCTGCCGCCGCGCCCCCGGTTTC
2chr1:3410956-34109793
GAAACCGGGGGCGCGGCGGCAGG
|||*||||||*|||*||||||||
GAAGCCGGGGCCGCAGCGGCAGG
3chr20:3219707-32197303
CCTGCCGCCGCGCCCCCGGTTTC
|*|*|||||||||||||||*|||
CGTCCCGCCGCGCCCCCGGATTC
1
Number of Mismatches:0
Location:chr12:6643630-6643653
Genomic Sequence:GAAACCGGGGGCGCGGCGGCAGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GAAACCGGGGGCGCGGCGGCAGG
Alignment:
GAAACCGGGGGCGCGGCGGCAGG
|||||||||||||||||||||||
GAAACCGGGGGCGCGGCGGCAGG
Mismatch:
2
Number of Mismatches:3
Location:chr1:3410956-3410979
Genomic Sequence:GAAGCCGGGGCCGCAGCGGCAGG
Strand:+
Genomic Region:exon(NM_001409.exon31)
3' PAM Orientation:GAAGCCGGGGCCGCAGCGGCAGG
Alignment:
GAAACCGGGGGCGCGGCGGCAGG
|||*||||||*|||*||||||||
GAAGCCGGGGCCGCAGCGGCAGG
Mismatch:
...G...................
..........C............
..............A........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr20:3219707-3219730
Genomic Sequence:GAATCCGGGGGCGCGGCGGGACG
Strand:-
Genomic Region:gene(SLC4A11)
3' PAM Orientation:GAATCCGGGGGCGCGGCGGGACG
Alignment:
GAAACCGGGGGCGCGGCGGCAGG
|||*|||||||||||||||*|*|
GAATCCGGGGGCGCGGCGGGACG
Mismatch:
...T...................
...................G...
.....................C.
Distal mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132286195
hs02571323170104
hs02571323271105
hs02571323374108
hs02571323586120
hs02571323687121
hs02571323790124
hs02571323895129
hs02571323996130
hs025713240100134

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
GlaIGCGCGCGCGAAACCGGGGGCGCGGCGGCAGG
HhaIGCGCGCGCGAAACCGGGGGCGCGGCGGCAGG
Fnu4HIGCNGCGCGGCGAAACCGGGGGCGCGGCGGCAGG
ScrFICCNGGCCGGGGAAACCGGGGGCGCGGCGGCAGG
HpaIICCGGCCGGGAAACCGGGGGCGCGGCGGCAGG
SecICCNNGGCCGGGGGAAACCGGGGGCGCGGCGGCAGG
FnuDIICGCGCGCGGAAACCGGGGGCGCGGCGGCAGG
RlaIVCWGCAGAAACCGGGGGCGCGGCGGCAGG
TauIGCSGCGCGGCGAAACCGGGGGCGCGGCGGCAGG
CauIICCSGGCCGGGGAAACCGGGGGCGCGGCGGCAGG
PsuGIBBCGDCGCGGGAAACCGGGGGCGCGGCGGCAGG
BisIGCNGCGCGGCGAAACCGGGGGCGCGGCGGCAGG

SNPs and Variation

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments