grID Information

Summary

grID: hs025713219
Sequence (23-mer): GCTCAATTTATAGAAACCGGGGG
grID Score: high (800)
Doench (2014) Score: 0.71275
Doench (2016) Score: 0.68182
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643665-6643643
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537765
NM_014865 NCAPD2chr12660329766411322533
NM_001039670 IFFO1chr12664869366652495050
NM_001193457 IFFO1chr12664869366652495050

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GCUCAAUUUAUAGAAACCGG
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 40
GC-score: low
Tm (°C): 43.15
Tm score: low
RNAfold (dot bracket): ....................
deltaG (Kcal/mol): 0.00
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 2
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 1
1chr12:6643642-66436650
CCCCCGGTTTCTATAAATTGAGC
|||||||||||||||||||||||
CCCCCGGTTTCTATAAATTGAGC
2chr4:118742933-1187429563
GCTCAATTTATAGAAACCGGGGG
|||||*||||||||||||*||*|
GCTCATTTTATAGAAACCAGGTG
1
Number of Mismatches:0
Location:chr12:6643642-6643665
Genomic Sequence:GCTCAATTTATAGAAACCGGGGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GCTCAATTTATAGAAACCGGGGG
Alignment:
GCTCAATTTATAGAAACCGGGGG
|||||||||||||||||||||||
GCTCAATTTATAGAAACCGGGGG
Mismatch:
2
Number of Mismatches:3
Location:chr4:118742933-118742956
Genomic Sequence:GCTCATTTTATAGAAACCAGGTG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GCTCATTTTATAGAAACCAGGTG
Alignment:
GCTCAATTTATAGAAACCGGGGG
|||||*||||||||||||*||*|
GCTCATTTTATAGAAACCAGGTG
Mismatch:
.....T.................
..................A....
.....................T.
Distal mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132284983
hs0257132315892
hs0257132325993
hs0257132336296
hs02571323574108
hs02571323675109
hs02571323778112
hs02571323883117
hs02571323984118
hs02571324088122
hs02571324296130
hs02571324399133

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
TspEIAATTAATTGCTCAATTTATAGAAACCGGGGG
CauIICCSGGCCGGGGCTCAATTTATAGAAACCGGGGG
FaiIYATRTATAGCTCAATTTATAGAAACCGGGGG
RlaIVCWGCTGCTCAATTTATAGAAACCGGGGG
SecICCNNGGCCGGGGGCTCAATTTATAGAAACCGGGGG
HpaIICCGGCCGGGCTCAATTTATAGAAACCGGGGG
ScrFICCNGGCCGGGGCTCAATTTATAGAAACCGGGGG

SNPs and Variation

Notes

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments