grID Information

Summary

grID: hs025713223
Sequence (23-mer): AGAGCGAAGCGGGAGGCTGCGGG
grID Score: moderate (600)
Doench (2014) Score: 0.02860
Doench (2016) Score: 0.42993
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643687-6643665
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537743
NM_014865 NCAPD2chr12660329766411322555
NM_001039670 IFFO1chr12664869366652495028
NM_001193457 IFFO1chr12664869366652495028

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): AGAGCGAAGCGGGAGGCUGC
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 70
GC-score: high
Tm (°C): 70.22
Tm score: high
RNAfold (dot bracket): ........((((....))))
deltaG (Kcal/mol): -4.00
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 4
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 3
1chr12:6643664-66436870
CCCGCAGCCTCCCGCTTCGCTCT
|||||||||||||||||||||||
CCCGCAGCCTCCCGCTTCGCTCT
2chr11:111383363-1113833863
AGAGCGAAGCGGGAGGCTGCGGG
*|||*|*||||||||||||||||
TGAGAGGAGCGGGAGGCTGCGGG
3chr17:56594750-565947733
AGAGCGAAGCGGGAGGCTGCGGG
|||||***|||||||||||||||
AGAGCCCTGCGGGAGGCTGCGGG
4chr7:134991311-1349913343
AGAGCGAAGCGGGAGGCTGCGGG
||||*||||*||||||||||*||
AGAGAGAAGTGGGAGGCTGCAGG
1
Number of Mismatches:0
Location:chr12:6643664-6643687
Genomic Sequence:AGAGCGAAGCGGGAGGCTGCGGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:AGAGCGAAGCGGGAGGCTGCGGG
Alignment:
AGAGCGAAGCGGGAGGCTGCGGG
|||||||||||||||||||||||
AGAGCGAAGCGGGAGGCTGCGGG
Mismatch:
2
Number of Mismatches:3
Location:chr11:111383363-111383386
Genomic Sequence:TGAGAGGAGCGGGAGGCTGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:TGAGAGGAGCGGGAGGCTGCGGG
Alignment:
AGAGCGAAGCGGGAGGCTGCGGG
*|||*|*||||||||||||||||
TGAGAGGAGCGGGAGGCTGCGGG
Mismatch:
T......................
....A..................
......G................
Distal mismatch
Distal mismatch
Distal mismatch
3
Number of Mismatches:3
Location:chr17:56594750-56594773
Genomic Sequence:AGAGCCCTGCGGGAGGCTGCGGG
Strand:+
Genomic Region:gene(MTMR4)
3' PAM Orientation:AGAGCCCTGCGGGAGGCTGCGGG
Alignment:
AGAGCGAAGCGGGAGGCTGCGGG
|||||***|||||||||||||||
AGAGCCCTGCGGGAGGCTGCGGG
Mismatch:
.....C.................
......C................
.......T...............
Distal mismatch
Distal mismatch
Distal seed mismatch
4
Number of Mismatches:3
Location:chr7:134991311-134991334
Genomic Sequence:AGAGAGAAGTGGGAGGCTGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGAGAGAAGTGGGAGGCTGCAGG
Alignment:
AGAGCGAAGCGGGAGGCTGCGGG
||||*||||*||||||||||*||
AGAGAGAAGTGGGAGGCTGCAGG
Mismatch:
....A..................
.........T.............
....................A..
Distal mismatch
Distal seed mismatch
PAM N Offtarget

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132282761
hs0257132313670
hs0257132323771
hs0257132334074
hs0257132355286
hs0257132365387
hs0257132375690
hs0257132386195
hs0257132396296
hs02571324066100
hs02571324274108
hs02571324377111
hs02571324481115
hs02571324582116
hs02571324683117
hs02571324786120
hs02571324887121
hs02571325193127
hs02571325297131

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
BisIGCNGCGCTGCAGAGCGAAGCGGGAGGCTGCGGG
Psp0357IIGCGAAGGCGAAGAGAGCGAAGCGGGAGGCTGCGGG
TseIGCWGCGCTGCAGAGCGAAGCGGGAGGCTGCGGG
Csp2014IGGAGGCGGAGGCAGAGCGAAGCGGGAGGCTGCGGG
CviJIRGCYGGCTAGAGCGAAGCGGGAGGCTGCGGG
RlaIVCWGCTAGAGCGAAGCGGGAGGCTGCGGG
SpoDIGCGGRAGGCGGGAGAGAGCGAAGCGGGAGGCTGCGGG
Cla11845IIIGCGAAGCGAAAGAGCGAAGCGGGAGGCTGCGGG
PsuGIBBCGDTGCGGAGAGCGAAGCGGGAGGCTGCGGG
Fnu4HIGCNGCGCTGCAGAGCGAAGCGGGAGGCTGCGGG
ApaKIGCWGCGCTGCAGAGCGAAGCGGGAGGCTGCGGG

SNPs and Variation

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments