grID Information

Summary

grID: hs025713224
Sequence (23-mer): GAGAGCGAAGCGGGAGGCTGCGG
grID Score: high (700)
Doench (2014) Score: 0.05843
Doench (2016) Score: 0.33911
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643688-6643666
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537742
NM_014865 NCAPD2chr12660329766411322556
NM_001039670 IFFO1chr12664869366652495027
NM_001193457 IFFO1chr12664869366652495027

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GAGAGCGAAGCGGGAGGCUG
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 70
GC-score: high
Tm (°C): 67.81
Tm score: moderate
RNAfold (dot bracket): ........(((.....))).
deltaG (Kcal/mol): -2.50
Predicted Folding: low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 5
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 4
1chr12:6643665-66436880
CCGCAGCCTCCCGCTTCGCTCTC
|||||||||||||||||||||||
CCGCAGCCTCCCGCTTCGCTCTC
2chr17:37307856-373078793
GAGAGCGAAGCGGGAGGCTGCGG
|*|||||*|||*|||||||||||
GCGAGCGGAGCTGGAGGCTGCGG
3chrX:12809534-128095573
CCGCAGCCTCCCGCTTCGCTCTC
|*||||||||||||*|||||*||
CGGCAGCCTCCCGCATCGCTGTC
4chr7:134991310-1349913333
GAGAGCGAAGCGGGAGGCTGCGG
|||||*||||*||||||||||*|
GAGAGAGAAGTGGGAGGCTGCAG
5chr6:29756872-297568953
CCGCAGCCTCCCGCTTCGCTCTC
|*||||||||||*||||*|||||
CGGCAGCCTCCCCCTTCCCTCTC
1
Number of Mismatches:0
Location:chr12:6643665-6643688
Genomic Sequence:GAGAGCGAAGCGGGAGGCTGCGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GAGAGCGAAGCGGGAGGCTGCGG
Alignment:
GAGAGCGAAGCGGGAGGCTGCGG
|||||||||||||||||||||||
GAGAGCGAAGCGGGAGGCTGCGG
Mismatch:
2
Number of Mismatches:3
Location:chr17:37307856-37307879
Genomic Sequence:GCGAGCGGAGCTGGAGGCTGCGG
Strand:+
Genomic Region:exon(NM_020405.exon0)
3' PAM Orientation:GCGAGCGGAGCTGGAGGCTGCGG
Alignment:
GAGAGCGAAGCGGGAGGCTGCGG
|*|||||*|||*|||||||||||
GCGAGCGGAGCTGGAGGCTGCGG
Mismatch:
.C.....................
.......G...............
...........T...........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chrX:12809534-12809557
Genomic Sequence:GACAGCGATGCGGGAGGCTGCCG
Strand:-
Genomic Region:exon(NM_002765.exon0)
3' PAM Orientation:GACAGCGATGCGGGAGGCTGCCG
Alignment:
GAGAGCGAAGCGGGAGGCTGCGG
||*|||||*||||||||||||*|
GACAGCGATGCGGGAGGCTGCCG
Mismatch:
..C....................
........T..............
.....................C.
Distal mismatch
Distal seed mismatch
PAM mismatch
4
Number of Mismatches:3
Location:chr7:134991310-134991333
Genomic Sequence:GAGAGAGAAGTGGGAGGCTGCAG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GAGAGAGAAGTGGGAGGCTGCAG
Alignment:
GAGAGCGAAGCGGGAGGCTGCGG
|||||*||||*||||||||||*|
GAGAGAGAAGTGGGAGGCTGCAG
Mismatch:
.....A.................
..........T............
.....................A.
Distal mismatch
Proximal seed mismatch
PAM mismatch
5
Number of Mismatches:3
Location:chr6:29756872-29756895
Genomic Sequence:GAGAGGGAAGGGGGAGGCTGCCG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GAGAGGGAAGGGGGAGGCTGCCG
Alignment:
GAGAGCGAAGCGGGAGGCTGCGG
|||||*||||*||||||||||*|
GAGAGGGAAGGGGGAGGCTGCCG
Mismatch:
.....G.................
..........G............
.....................C.
Distal mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132282660
hs0257132313569
hs0257132323670
hs0257132333973
hs0257132355185
hs0257132365286
hs0257132375589
hs0257132386094
hs0257132396195
hs0257132406599
hs02571324273107
hs02571324376110
hs02571324480114
hs02571324581115
hs02571324682116
hs02571324785119
hs02571324886120
hs02571325192126
hs02571325296130

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
RlaIVCWGCTGAGAGCGAAGCGGGAGGCTGCGG
Cla11845IIIGCGAAGCGAAGAGAGCGAAGCGGGAGGCTGCGG
Psp0357IIGCGAAGGCGAAGGAGAGCGAAGCGGGAGGCTGCGG
Fnu4HIGCNGCGCTGCGAGAGCGAAGCGGGAGGCTGCGG
Csp2014IGGAGGCGGAGGCGAGAGCGAAGCGGGAGGCTGCGG
TseIGCWGCGCTGCGAGAGCGAAGCGGGAGGCTGCGG
BisIGCNGCGCTGCGAGAGCGAAGCGGGAGGCTGCGG
ApaKIGCWGCGCTGCGAGAGCGAAGCGGGAGGCTGCGG
PsuGIBBCGDTGCGGGAGAGCGAAGCGGGAGGCTGCGG
CviJIRGCYGGCTGAGAGCGAAGCGGGAGGCTGCGG
SpoDIGCGGRAGGCGGGAGGAGAGCGAAGCGGGAGGCTGCGG

SNPs and Variation

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments