grID Information

Summary

grID: hs025713225
Sequence (23-mer): GGAGCAGAGAGCGAAGCGGGAGG
grID Score: moderate (400)
Doench (2014) Score: 0.44736
Doench (2016) Score: 0.57389
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643694-6643672
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537736
NM_014865 NCAPD2chr12660329766411322562
NM_001039670 IFFO1chr12664869366652495021
NM_001193457 IFFO1chr12664869366652495021

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GGAGCAGAGAGCGAAGCGGG
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 70
GC-score: high
Tm (°C): 68.13
Tm score: moderate
RNAfold (dot bracket): ...((.....))........
deltaG (Kcal/mol): -0.50
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 38
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches: 3
Total Genomic Sites With 3 Mismatches: 34
1chr12:6643671-66436940
CCTCCCGCTTCGCTCTCTGCTCC
|||||||||||||||||||||||
CCTCCCGCTTCGCTCTCTGCTCC
2chr16:1630456-16304792
CCTCCCGCTTCGCTCTCTGCTCC
||||||||||||||||||**|||
CCTCCCGCTTCGCTCTCTCGTCC
3chr8:144272925-1442729482
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||||||||||*|||
GGAGGAGAGAGCGAAGCGGAAGG
4chr8:125526502-1255265252
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*|||*|||||||||||
GGAGCAGGGAGGGAAGCGGGAGG
5chr4:126512861-1265128843
GGAGCAGAGAGCGAAGCGGGAGG
|||**|*||||||||||||||||
GGAAGACAGAGCGAAGCGGGAGG
6chr16:75822470-758224933
CCTCCCGCTTCGCTCTCTGCTCC
||||||||||||||||||*|**|
CCTCCCGCTTCGCTCTCTCCAGC
7chr22:40232813-402328363
CCTCCCGCTTCGCTCTCTGCTCC
||||||||||||||||||*|**|
CCTCCCGCTTCGCTCTCTCCAGC
8chr7:100281024-1002810473
CCTCCCGCTTCGCTCTCTGCTCC
|||||||||||||*||**|||||
CCTCCCGCTTCGCACTGAGCTCC
9chr1:241564676-2415646993
GGAGCAGAGAGCGAAGCGGGAGG
|**|*||||||||||||||||||
GAGGAAGAGAGCGAAGCGGGAGG
10chr4:70540963-705409863
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||*||||||||||
GGAAGAGAGAGCAAAGCGGGAGG
11chr3:186910288-1869103113
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||||||*||||||
GGAAGAGAGAGCGAAGGGGGAGG
12chr1:6784296-67843193
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||||||*||||||
GGAAAAGAGAGCGAAGGGGGAGG
13chr6:161402844-1614028673
CCTCCCGCTTCGCTCTCTGCTCC
||||||*|||||||||||**|||
CCTCCCCCTTCGCTCTCTCGTCC
14chr5:122976932-1229769553
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||*||||||||||
GGAAGAGAGAGCAAAGCGGGAGG
15chr5:137802419-1378024423
CCTCCCGCTTCGCTCTCTGCTCC
|||||||||||*||||||*||*|
CCTCCCGCTTCCCTCTCTCCTGC
16chr17:34901384-349014073
CCTCCCGCTTCGCTCTCTGCTCC
|||||||||*|||||*||||*||
CCTCCCGCTACGCTCACTGCACC
17chr2:241346735-2413467583
CCTCCCGCTTCGCTCTCTGCTCC
|||||||||||*||||||**|||
CCTCCCGCTTCCCTCTCTCGTCC
18chr17:71467268-714672913
CCTCCCGCTTCGCTCTCTGCTCC
||||||*||||*||||||||*||
CCTCCCCCTTCCCTCTCTGCACC
19chr18:56972450-569724733
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*||*||||||*|||||
GGAGCAGGGAACGAAGCAGGAGG
20chr5:172074238-1720742613
GGAGCAGAGAGCGAAGCGGGAGG
*||||||||||*||||*||||||
AGAGCAGAGAGGGAAGAGGGAGG
21chr11:118767688-1187677113
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*||||*|||*||||||
GGAGCAGGGAGCCAAGGGGGAGG
22chr10:115500475-1155004983
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*||||||*|*||||||
GGAGCAGGGAGCGAGGTGGGAGG
23chr19:34165551-341655743
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*|||*|*|||||||||
GGAGCAGGGAGAGGAGCGGGAGG
24chr10:104503676-1045036993
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||***|||||||||||
GGAGCAGAGCCGGAAGCGGGAGG
25chr19:1790197-17902203
CCTCCCGCTTCGCTCTCTGCTCC
||||||*||||*||||||*||||
CCTCCCCCTTCCCTCTCTCCTCC
26chrX:25447138-254471613
CCTCCCGCTTCGCTCTCTGCTCC
||||||*||||*||||||*||||
CCTCCCCCTTCCCTCTCTCCTCC
27chr19:8018195-80182183
CCTCCCGCTTCGCTCTCTGCTCC
||||||*||||*||||||*||||
CCTCCCCCTTCCCTCTCTCCTCC
28chr20:12613995-126140183
CCTCCCGCTTCGCTCTCTGCTCC
||||||*||||*||||||*||||
CCTCCCCCTTCCCTCTCTCCTCC
29chrX:49524184-495242073
GGAGCAGAGAGCGAAGCGGGAGG
|||*||||||||||||*||||*|
GGAACAGAGAGCGAAGGGGGAAG
30chr5:89676139-896761623
CCTCCCGCTTCGCTCTCTGCTCC
|||*|||||||*||||||*||||
CCTGCCGCTTCCCTCTCTCCTCC
31chr16:79781007-797810303
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*||||*||||||
GGAGAAGAGAGAGAAGAGGGAGG
32chr9:38691218-386912413
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||*||||**|||||
GGAGCAGAGAGAGAAGGAGGAGG
33chr11:57009805-570098283
CCTCCCGCTTCGCTCTCTGCTCC
||||||*|*|*||||||||||||
CCTCCCCCATGGCTCTCTGCTCC
34chr7:28199075-281990983
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||**|*||||||||
GGAGCAGAGAGGAAGGCGGGAGG
35chr10:6078396-60784193
CCTCCCGCTTCGCTCTCTGCTCC
|||*||||*||*|||||||||||
CCTGCCGCATCCCTCTCTGCTCC
36chr19:3551831-35518543
CCTCCCGCTTCGCTCTCTGCTCC
*|||||*||||*|||||||||||
GCTCCCCCTTCCCTCTCTGCTCC
37chr3:11174765-111747883
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||*||||||||**|
GGAGCAGAGAGTGAAGCGGGGAG
38chr6:160390328-1603903513
CCTCCCGCTTCGCTCTCTGCTCC
||*|||||**|||||||||||||
CCACCCGCAACGCTCTCTGCTCC
1
Number of Mismatches:0
Location:chr12:6643671-6643694
Genomic Sequence:GGAGCAGAGAGCGAAGCGGGAGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GGAGCAGAGAGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||||||||||||||
GGAGCAGAGAGCGAAGCGGGAGG
Mismatch:
2
Number of Mismatches:2
Location:chr16:1630456-1630479
Genomic Sequence:GGACGAGAGAGCGAAGCGGGAGG
Strand:-
Genomic Region:gene(IFT140)
3' PAM Orientation:GGACGAGAGAGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**||||||||||||||||||
GGACGAGAGAGCGAAGCGGGAGG
Mismatch:
...C...................
....G..................
Distal mismatch
Distal mismatch
3
Number of Mismatches:2
Location:chr8:144272925-144272948
Genomic Sequence:GGAGGAGAGAGCGAAGCGGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGAGAGCGAAGCGGAAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||||||||||*|||
GGAGGAGAGAGCGAAGCGGAAGG
Mismatch:
....G..................
...................A...
Distal mismatch
Proximal seed mismatch
4
Number of Mismatches:2
Location:chr8:125526502-125526525
Genomic Sequence:GGAGCAGGGAGGGAAGCGGGAGG
Strand:+
Genomic Region:gene(TATDN1)
3' PAM Orientation:GGAGCAGGGAGGGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*|||*|||||||||||
GGAGCAGGGAGGGAAGCGGGAGG
Mismatch:
.......G...............
...........G...........
Distal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr4:126512861-126512884
Genomic Sequence:GGAAGACAGAGCGAAGCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAAGACAGAGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**|*||||||||||||||||
GGAAGACAGAGCGAAGCGGGAGG
Mismatch:
...A...................
....G..................
......C................
Distal mismatch
Distal mismatch
Distal mismatch
6
Number of Mismatches:3
Location:chr16:75822470-75822493
Genomic Sequence:GCTGGAGAGAGCGAAGCGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GCTGGAGAGAGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|**|*||||||||||||||||||
GCTGGAGAGAGCGAAGCGGGAGG
Mismatch:
.C.....................
..T....................
....G..................
Distal mismatch
Distal mismatch
Distal mismatch
7
Number of Mismatches:3
Location:chr22:40232813-40232836
Genomic Sequence:GCTGGAGAGAGCGAAGCGGGAGG
Strand:-
Genomic Region:gene(ENTHD1)
3' PAM Orientation:GCTGGAGAGAGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|**|*||||||||||||||||||
GCTGGAGAGAGCGAAGCGGGAGG
Mismatch:
.C.....................
..T....................
....G..................
Distal mismatch
Distal mismatch
Distal mismatch
8
Number of Mismatches:3
Location:chr7:100281024-100281047
Genomic Sequence:GGAGCTCAGTGCGAAGCGGGAGG
Strand:-
Genomic Region:exon(NM_022574.exon17)
3' PAM Orientation:GGAGCTCAGTGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||**||*|||||||||||||
GGAGCTCAGTGCGAAGCGGGAGG
Mismatch:
.....T.................
......C................
.........T.............
Distal mismatch
Distal mismatch
Distal seed mismatch
9
Number of Mismatches:3
Location:chr1:241564676-241564699
Genomic Sequence:GAGGAAGAGAGCGAAGCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GAGGAAGAGAGCGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|**|*||||||||||||||||||
GAGGAAGAGAGCGAAGCGGGAGG
Mismatch:
.A.....................
..G....................
....A..................
Distal mismatch
Distal mismatch
Distal mismatch
10
Number of Mismatches:3
Location:chr4:70540963-70540986
Genomic Sequence:GGAAGAGAGAGCAAAGCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAAGAGAGAGCAAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||*||||||||||
GGAAGAGAGAGCAAAGCGGGAGG
Mismatch:
...A...................
....G..................
............A..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr3:186910288-186910311
Genomic Sequence:GGAAGAGAGAGCGAAGGGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAAGAGAGAGCGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||||||*||||||
GGAAGAGAGAGCGAAGGGGGAGG
Mismatch:
...A...................
....G..................
................G......
Distal mismatch
Distal mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chr1:6784296-6784319
Genomic Sequence:GGAAAAGAGAGCGAAGGGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAAAAGAGAGCGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||||||*||||||
GGAAAAGAGAGCGAAGGGGGAGG
Mismatch:
...A...................
....A..................
................G......
Distal mismatch
Distal mismatch
Proximal seed mismatch
13
Number of Mismatches:3
Location:chr6:161402844-161402867
Genomic Sequence:GGACGAGAGAGCGAAGGGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGACGAGAGAGCGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||||||*||||||
GGACGAGAGAGCGAAGGGGGAGG
Mismatch:
...C...................
....G..................
................G......
Distal mismatch
Distal mismatch
Proximal seed mismatch
14
Number of Mismatches:3
Location:chr5:122976932-122976955
Genomic Sequence:GGAAGAGAGAGCAAAGCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAAGAGAGAGCAAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**|||||||*||||||||||
GGAAGAGAGAGCAAAGCGGGAGG
Mismatch:
...A...................
....G..................
............A..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr5:137802419-137802442
Genomic Sequence:GCAGGAGAGAGGGAAGCGGGAGG
Strand:-
Genomic Region:gene(EGR1)
3' PAM Orientation:GCAGGAGAGAGGGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|*||*||||||*|||||||||||
GCAGGAGAGAGGGAAGCGGGAGG
Mismatch:
.C.....................
....G..................
...........G...........
Distal mismatch
Distal mismatch
Proximal seed mismatch
16
Number of Mismatches:3
Location:chr17:34901384-34901407
Genomic Sequence:GGTGCAGTGAGCGTAGCGGGAGG
Strand:-
Genomic Region:gene(GGNBP2)
3' PAM Orientation:GGTGCAGTGAGCGTAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||*||||*|||||*|||||||||
GGTGCAGTGAGCGTAGCGGGAGG
Mismatch:
..T....................
.......T...............
.............T.........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
17
Number of Mismatches:3
Location:chr2:241346735-241346758
Genomic Sequence:GGACGAGAGAGGGAAGCGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGACGAGAGAGGGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||**||||||*|||||||||||
GGACGAGAGAGGGAAGCGGGAGG
Mismatch:
...C...................
....G..................
...........G...........
Distal mismatch
Distal mismatch
Proximal seed mismatch
18
Number of Mismatches:3
Location:chr17:71467268-71467291
Genomic Sequence:GGTGCAGAGAGGGAAGGGGGAGG
Strand:-
Genomic Region:gene(SDK2)
3' PAM Orientation:GGTGCAGAGAGGGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||*||||||||*||||*||||||
GGTGCAGAGAGGGAAGGGGGAGG
Mismatch:
..T....................
...........G...........
................G......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
19
Number of Mismatches:3
Location:chr18:56972450-56972473
Genomic Sequence:GGAGCAGGGAACGAAGCAGGAGG
Strand:+
Genomic Region:gene(CPLX4)
3' PAM Orientation:GGAGCAGGGAACGAAGCAGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*||*||||||*|||||
GGAGCAGGGAACGAAGCAGGAGG
Mismatch:
.......G...............
..........A............
.................A.....
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
20
Number of Mismatches:3
Location:chr5:172074238-172074261
Genomic Sequence:AGAGCAGAGAGGGAAGAGGGAGG
Strand:+
Genomic Region:gene(NEURL1B)
3' PAM Orientation:AGAGCAGAGAGGGAAGAGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
*||||||||||*||||*||||||
AGAGCAGAGAGGGAAGAGGGAGG
Mismatch:
A......................
...........G...........
................A......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
21
Number of Mismatches:3
Location:chr11:118767688-118767711
Genomic Sequence:GGAGCAGGGAGCCAAGGGGGAGG
Strand:+
Genomic Region:three(NM_182557.utr7)
3' PAM Orientation:GGAGCAGGGAGCCAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*||||*|||*||||||
GGAGCAGGGAGCCAAGGGGGAGG
Mismatch:
.......G...............
............C..........
................G......
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
22
Number of Mismatches:3
Location:chr10:115500475-115500498
Genomic Sequence:GGAGCAGGGAGCGAGGTGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGCAGGGAGCGAGGTGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*||||||*|*||||||
GGAGCAGGGAGCGAGGTGGGAGG
Mismatch:
.......G...............
..............G........
................T......
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
23
Number of Mismatches:3
Location:chr19:34165551-34165574
Genomic Sequence:GGAGCAGGGAGAGGAGCGGGAGG
Strand:+
Genomic Region:gene(CHST8)
3' PAM Orientation:GGAGCAGGGAGAGGAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||*|||*|*|||||||||
GGAGCAGGGAGAGGAGCGGGAGG
Mismatch:
.......G...............
...........A...........
.............G.........
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
24
Number of Mismatches:3
Location:chr10:104503676-104503699
Genomic Sequence:GGAGCAGAGCCGGAAGCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGCAGAGCCGGAAGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||***|||||||||||
GGAGCAGAGCCGGAAGCGGGAGG
Mismatch:
.........C.............
..........C............
...........G...........
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
25
Number of Mismatches:3
Location:chr19:1790197-1790220
Genomic Sequence:GGAGGAGAGAGGGAAGGGGGAGG
Strand:-
Genomic Region:gene(ATP8B3)
3' PAM Orientation:GGAGGAGAGAGGGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*||||*||||||
GGAGGAGAGAGGGAAGGGGGAGG
Mismatch:
....G..................
...........G...........
................G......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
26
Number of Mismatches:3
Location:chrX:25447138-25447161
Genomic Sequence:GGAGGAGAGAGGGAAGGGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGAGAGGGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*||||*||||||
GGAGGAGAGAGGGAAGGGGGAGG
Mismatch:
....G..................
...........G...........
................G......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
27
Number of Mismatches:3
Location:chr19:8018195-8018218
Genomic Sequence:GGAGGAGAGAGGGAAGGGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGAGAGGGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*||||*||||||
GGAGGAGAGAGGGAAGGGGGAGG
Mismatch:
....G..................
...........G...........
................G......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
28
Number of Mismatches:3
Location:chr20:12613995-12614018
Genomic Sequence:GGAGGAGAGAGGGAAGGGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGAGAGGGAAGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*||||*||||||
GGAGGAGAGAGGGAAGGGGGAGG
Mismatch:
....G..................
...........G...........
................G......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
29
Number of Mismatches:3
Location:chrX:49524184-49524207
Genomic Sequence:GGAACAGAGAGCGAAGGGGGAAG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAACAGAGAGCGAAGGGGGAAG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||*||||||||||||*||||*|
GGAACAGAGAGCGAAGGGGGAAG
Mismatch:
...A...................
................G......
.....................A.
Distal mismatch
Proximal seed mismatch
PAM mismatch
30
Number of Mismatches:3
Location:chr5:89676139-89676162
Genomic Sequence:GGAGGAGAGAGGGAAGCGGCAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGAGAGGGAAGCGGCAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*|||||||*|||
GGAGGAGAGAGGGAAGCGGCAGG
Mismatch:
....G..................
...........G...........
...................C...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
31
Number of Mismatches:3
Location:chr16:79781007-79781030
Genomic Sequence:GGAGAAGAGAGAGAAGAGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGAAGAGAGAGAAGAGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||*||||||*||||*||||||
GGAGAAGAGAGAGAAGAGGGAGG
Mismatch:
....A..................
...........A...........
................A......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
32
Number of Mismatches:3
Location:chr9:38691218-38691241
Genomic Sequence:GGAGCAGAGAGAGAAGGAGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGCAGAGAGAGAAGGAGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||*||||**|||||
GGAGCAGAGAGAGAAGGAGGAGG
Mismatch:
...........A...........
................G......
.................A.....
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
33
Number of Mismatches:3
Location:chr11:57009805-57009828
Genomic Sequence:GGAGCAGAGAGCCATGGGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGCAGAGAGCCATGGGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
||||||||||||*|*|*||||||
GGAGCAGAGAGCCATGGGGGAGG
Mismatch:
............C..........
..............T........
................G......
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
34
Number of Mismatches:3
Location:chr7:28199075-28199098
Genomic Sequence:GGAGCAGAGAGGAAGGCGGGAGG
Strand:+
Genomic Region:gene(JAZF1)
3' PAM Orientation:GGAGCAGAGAGGAAGGCGGGAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||**|*||||||||
GGAGCAGAGAGGAAGGCGGGAGG
Mismatch:
...........G...........
............A..........
..............G........
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
35
Number of Mismatches:3
Location:chr10:6078396-6078419
Genomic Sequence:GGAGCAGAGAGGGATGCGGCAGG
Strand:-
Genomic Region:gene(IL2RA)
3' PAM Orientation:GGAGCAGAGAGGGATGCGGCAGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||*||*||||*|||
GGAGCAGAGAGGGATGCGGCAGG
Mismatch:
...........G...........
..............T........
...................C...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
36
Number of Mismatches:3
Location:chr19:3551831-3551854
Genomic Sequence:GGAGCAGAGAGGGAAGGGGGAGC
Strand:-
Genomic Region:gene(MFSD12)
3' PAM Orientation:GGAGCAGAGAGGGAAGGGGGAGC
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||*||||*|||||*
GGAGCAGAGAGGGAAGGGGGAGC
Mismatch:
...........G...........
................G......
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
37
Number of Mismatches:3
Location:chr3:11174765-11174788
Genomic Sequence:GGAGCAGAGAGTGAAGCGGGGAG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGCAGAGAGTGAAGCGGGGAG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||*||||||||**|
GGAGCAGAGAGTGAAGCGGGGAG
Mismatch:
...........T...........
....................G..
.....................A.
Proximal seed mismatch
PAM N Offtarget
PAM mismatch
38
Number of Mismatches:3
Location:chr6:160390328-160390351
Genomic Sequence:GGAGCAGAGAGCGTTGCGGGTGG
Strand:-
Genomic Region:exon(NM_000876.exon0)
3' PAM Orientation:GGAGCAGAGAGCGTTGCGGGTGG
Alignment:
GGAGCAGAGAGCGAAGCGGGAGG
|||||||||||||**|||||*||
GGAGCAGAGAGCGTTGCGGGTGG
Mismatch:
.............T.........
..............T........
....................T..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132282054
hs0257132312963
hs0257132323064
hs0257132333367
hs0257132354579
hs0257132364680
hs0257132374983
hs0257132385488
hs0257132395589
hs0257132405993
hs02571324267101
hs02571324370104
hs02571324474108
hs02571324575109
hs02571324676110
hs02571324779113
hs02571324880114
hs02571325186120
hs02571325290124

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Psp10HIIGRAGCAGGGAGCAGGGAGCAGAGAGCGAAGCGGGAGG
Cla11845IIIGCGAAGCGAAGGAGCAGAGAGCGAAGCGGGAGG
Psp0357IIGCGAAGGCGAAGGGAGCAGAGAGCGAAGCGGGAGG
SpoDIGCGGRAGGCGGGAGGGAGCAGAGAGCGAAGCGGGAGG
RlaIVCWGCAGGAGCAGAGAGCGAAGCGGGAGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments