grID Information

Summary

grID: hs025713226
Sequence (23-mer): GGAGGAGCAGAGAGCGAAGCGGG
grID Score: moderate (600)
Doench (2014) Score: 0.20945
Doench (2016) Score: 0.40041
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643697-6643675
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537733
NM_014865 NCAPD2chr12660329766411322565
NM_001039670 IFFO1chr12664869366652495018
NM_001193457 IFFO1chr12664869366652495018

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GGAGGAGCAGAGAGCGAAGC
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 65
GC-score: high
Tm (°C): 69.76
Tm score: high
RNAfold (dot bracket): ......((.....)).....
deltaG (Kcal/mol): -0.50
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 37
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches: 1
Total Genomic Sites With 2 Mismatches: 4
Total Genomic Sites With 3 Mismatches: 31
1chr12:6643674-66436970
CCCGCTTCGCTCTCTGCTCCTCC
|||||||||||||||||||||||
CCCGCTTCGCTCTCTGCTCCTCC
2chr3:11174762-111747851
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||||||||
GGAGGAGCAGAGAGTGAAGCGGG
3chr16:1630459-16304822
CCCGCTTCGCTCTCTGCTCCTCC
|||||||||||||||**||||||
CCCGCTTCGCTCTCTCGTCCTCC
4chr8:144272922-1442729452
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||||||||||*
GGAGGAGGAGAGAGCGAAGCGGA
5chrX:49524181-495242042
GGAGGAGCAGAGAGCGAAGCGGG
||||||*||||||||||||*|||
GGAGGAACAGAGAGCGAAGGGGG
6chr6:35369237-353692602
CCCGCTTCGCTCTCTGCTCCTCC
|||*|||*|||||||||||||||
CCCCCTTGGCTCTCTGCTCCTCC
7chr7:104156643-1041566663
GGAGGAGCAGAGAGCGAAGCGGG
||||*||*|*|||||||||||||
GGAGAAGTACAGAGCGAAGCGGG
8chr4:126512858-1265128813
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|*|||||||||||||
GGAGGAAGACAGAGCGAAGCGGG
9chr1:36549720-365497433
GGAGGAGCAGAGAGCGAAGCGGG
||*||*||*||||||||||||||
GGGGGCGCGGAGAGCGAAGCGGG
10chr1:6784293-67843163
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGAAAAGAGAGCGAAGGGGG
11chr14:83036371-830363943
CCCGCTTCGCTCTCTGCTCCTCC
|||||||*|||||||**||||||
CCCGCTTGGCTCTCTCGTCCTCC
12chrX:27143840-271438633
CCCGCTTCGCTCTCTGCTCCTCC
|||*|||||||||||**||||||
CCCCCTTCGCTCTCTCGTCCTCC
13chr5:16055462-160554853
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGACGAGAGAGCGAAGTGGG
14chr3:186910285-1869103083
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGAAGAGAGAGCGAAGGGGG
15chr12:13016230-130162533
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGAAGAGAGAGCGAAGGGGG
16chr15:45326883-453269063
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||||||||*||*|||||
CCCCCTTCGCTCTCAGCACCTCC
17chr5:122976929-1229769523
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||*|||||||
GGAGGAAGAGAGAGCAAAGCGGG
18chr4:17424832-174248553
GGAGGAGCAGAGAGCGAAGCGGG
||||||*||||||||*|||*|||
GGAGGAACAGAGAGCAAAGGGGG
19chr6:160390331-1603903543
CCCGCTTCGCTCTCTGCTCCTCC
|||||**||||||||||||||*|
CCCGCAACGCTCTCTGCTCCTGC
20chr13:77396113-773961363
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*||||||||||||*|
CCCCCTTCCCTCTCTGCTCCTGC
21chr3:58552431-585524543
GGAGGAGCAGAGAGCGAAGCGGG
||||*|||||||||*||||*|||
GGAGAAGCAGAGAGTGAAGTGGG
22chr19:49897349-498973723
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*|||||*||||||||
CCCCCTTCCCTCTCAGCTCCTCC
23chr10:93438058-934380813
GGAGGAGCAGAGAGCGAAGCGGG
||*|||||||||||*|||||*||
GGGGGAGCAGAGAGAGAAGCAGG
24chr1:32928768-329287913
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*||||||*|||||||
CCCCCTTCCCTCTCTCCTCCTCC
25chr19:8018198-80182213
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*||||||*|||||||
CCCCCTTCCCTCTCTCCTCCTCC
26chr15:41164701-411647243
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*||||||*|||||||
CCCCCTTCCCTCTCTCCTCCTCC
27chr9:976282-9763053
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*|||||||*
GGAGGAGAAGAGAGAGAAGCGGA
28chr21:44794818-447948413
GGAGGAGCAGAGAGCGAAGCGGG
*|||||||||||||*|||*||||
AGAGGAGCAGAGAGGGAACCGGG
29chr11:59965352-599653753
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*||||||*|||||||
CCCCCTTCCCTCTCTCCTCCTCC
30chr20:12613998-126140213
CCCGCTTCGCTCTCTGCTCCTCC
|||*||||*||||||*|||||||
CCCCCTTCCCTCTCTCCTCCTCC
31chr1:155101397-1551014203
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||*|||*||||*|||
GGAGGAGCAGGGAGAGAAGTGGG
32chr10:133184898-1331849213
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||*|*|||||||*
GGAGGAGCAGAGGGAGAAGCGGA
33chr10:32430181-324302043
GGAGGAGCAGAGAGCGAAGCGGG
|||||||||||||*|*|||*|||
GGAGGAGCAGAGATCTAAGAGGG
34chr10:6078399-60784223
CCCGCTTCGCTCTCTGCTCCTCC
*||||*||*||||||||||||||
GCCGCATCCCTCTCTGCTCCTCC
35chr16:90026481-900265043
GGAGGAGCAGAGAGCGAAGCGGG
|||||||||||||||*|*|*|||
GGAGGAGCAGAGAGCCAGGTGGG
36chr16:8960538-89605613
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||*|*|||
GGAGGAGCAGAGAGAGAGGAGGG
37chr8:24564876-245648993
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||||*|*|
GGAGGAGCAGAGAGAGAAGAGTG
1
Number of Mismatches:0
Location:chr12:6643674-6643697
Genomic Sequence:GGAGGAGCAGAGAGCGAAGCGGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GGAGGAGCAGAGAGCGAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||||||||||||||||||
GGAGGAGCAGAGAGCGAAGCGGG
Mismatch:
2
Number of Mismatches:1
Location:chr3:11174762-11174785
Genomic Sequence:GGAGGAGCAGAGAGTGAAGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGCAGAGAGTGAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||||||||
GGAGGAGCAGAGAGTGAAGCGGG
Mismatch:
..............T........
Proximal seed mismatch
3
Number of Mismatches:2
Location:chr16:1630459-1630482
Genomic Sequence:GGAGGACGAGAGAGCGAAGCGGG
Strand:-
Genomic Region:gene(IFT140)
3' PAM Orientation:GGAGGACGAGAGAGCGAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||||||
GGAGGACGAGAGAGCGAAGCGGG
Mismatch:
......C................
.......G...............
Distal mismatch
Distal seed mismatch
4
Number of Mismatches:2
Location:chr8:144272922-144272945
Genomic Sequence:GGAGGAGGAGAGAGCGAAGCGGA
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGGAGAGAGCGAAGCGGA
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||||||||||*
GGAGGAGGAGAGAGCGAAGCGGA
Mismatch:
.......G...............
......................A
Distal seed mismatch
PAM mismatch
5
Number of Mismatches:2
Location:chrX:49524181-49524204
Genomic Sequence:GGAGGAACAGAGAGCGAAGGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAACAGAGAGCGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||*||||||||||||*|||
GGAGGAACAGAGAGCGAAGGGGG
Mismatch:
......A................
...................G...
Distal mismatch
Proximal seed mismatch
6
Number of Mismatches:2
Location:chr6:35369237-35369260
Genomic Sequence:GGAGGAGCAGAGAGCCAAGGGGG
Strand:-
Genomic Region:gene(PPARD)
3' PAM Orientation:GGAGGAGCAGAGAGCCAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||||||||||*|||*|||
GGAGGAGCAGAGAGCCAAGGGGG
Mismatch:
...............C.......
...................G...
Proximal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr7:104156643-104156666
Genomic Sequence:GGAGAAGTACAGAGCGAAGCGGG
Strand:+
Genomic Region:gene(LHFPL3)
3' PAM Orientation:GGAGAAGTACAGAGCGAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||*||*|*|||||||||||||
GGAGAAGTACAGAGCGAAGCGGG
Mismatch:
....A..................
.......T...............
.........C.............
Distal mismatch
Distal seed mismatch
Distal seed mismatch
8
Number of Mismatches:3
Location:chr4:126512858-126512881
Genomic Sequence:GGAGGAAGACAGAGCGAAGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAAGACAGAGCGAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|*|||||||||||||
GGAGGAAGACAGAGCGAAGCGGG
Mismatch:
......A................
.......G...............
.........C.............
Distal mismatch
Distal seed mismatch
Distal seed mismatch
9
Number of Mismatches:3
Location:chr1:36549720-36549743
Genomic Sequence:GGGGGCGCGGAGAGCGAAGCGGG
Strand:+
Genomic Region:exon(NM_014466.exon0)
3' PAM Orientation:GGGGGCGCGGAGAGCGAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||*||*||*||||||||||||||
GGGGGCGCGGAGAGCGAAGCGGG
Mismatch:
..G....................
.....C.................
........G..............
Distal mismatch
Distal mismatch
Distal seed mismatch
10
Number of Mismatches:3
Location:chr1:6784293-6784316
Genomic Sequence:GGAGGAAAAGAGAGCGAAGGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAAAAGAGAGCGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGAAAAGAGAGCGAAGGGGG
Mismatch:
......A................
.......A...............
...................G...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr14:83036371-83036394
Genomic Sequence:GGAGGACGAGAGAGCCAAGCGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGACGAGAGAGCCAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||*|||||||
GGAGGACGAGAGAGCCAAGCGGG
Mismatch:
......C................
.......G...............
...............C.......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chrX:27143840-27143863
Genomic Sequence:GGAGGACGAGAGAGCGAAGGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGACGAGAGAGCGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGACGAGAGAGCGAAGGGGG
Mismatch:
......C................
.......G...............
...................G...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
13
Number of Mismatches:3
Location:chr5:16055462-16055485
Genomic Sequence:GGAGGACGAGAGAGCGAAGTGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGACGAGAGAGCGAAGTGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGACGAGAGAGCGAAGTGGG
Mismatch:
......C................
.......G...............
...................T...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
14
Number of Mismatches:3
Location:chr3:186910285-186910308
Genomic Sequence:GGAGGAAGAGAGAGCGAAGGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAAGAGAGAGCGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGAAGAGAGAGCGAAGGGGG
Mismatch:
......A................
.......G...............
...................G...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr12:13016230-13016253
Genomic Sequence:GGAGGAAGAGAGAGCGAAGGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAAGAGAGAGCGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||||||*|||
GGAGGAAGAGAGAGCGAAGGGGG
Mismatch:
......A................
.......G...............
...................G...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
16
Number of Mismatches:3
Location:chr15:45326883-45326906
Genomic Sequence:GGAGGTGCTGAGAGCGAAGGGGG
Strand:-
Genomic Region:gene(SORD)
3' PAM Orientation:GGAGGTGCTGAGAGCGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||*||*||||||||||*|||
GGAGGTGCTGAGAGCGAAGGGGG
Mismatch:
.....T.................
........T..............
...................G...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
17
Number of Mismatches:3
Location:chr5:122976929-122976952
Genomic Sequence:GGAGGAAGAGAGAGCAAAGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAAGAGAGAGCAAAGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||**|||||||*|||||||
GGAGGAAGAGAGAGCAAAGCGGG
Mismatch:
......A................
.......G...............
...............A.......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
18
Number of Mismatches:3
Location:chr4:17424832-17424855
Genomic Sequence:GGAGGAACAGAGAGCAAAGGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAACAGAGAGCAAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||*||||||||*|||*|||
GGAGGAACAGAGAGCAAAGGGGG
Mismatch:
......A................
...............A.......
...................G...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
19
Number of Mismatches:3
Location:chr6:160390331-160390354
Genomic Sequence:GCAGGAGCAGAGAGCGTTGCGGG
Strand:-
Genomic Region:exon(NM_000876.exon0)
3' PAM Orientation:GCAGGAGCAGAGAGCGTTGCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|*||||||||||||||**|||||
GCAGGAGCAGAGAGCGTTGCGGG
Mismatch:
.C.....................
................T......
.................T.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
20
Number of Mismatches:3
Location:chr13:77396113-77396136
Genomic Sequence:GCAGGAGCAGAGAGGGAAGGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GCAGGAGCAGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|*||||||||||||*||||*|||
GCAGGAGCAGAGAGGGAAGGGGG
Mismatch:
.C.....................
..............G........
...................G...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
21
Number of Mismatches:3
Location:chr3:58552431-58552454
Genomic Sequence:GGAGAAGCAGAGAGTGAAGTGGG
Strand:+
Genomic Region:mRNA(NM_001076778)
3' PAM Orientation:GGAGAAGCAGAGAGTGAAGTGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||*|||||||||*||||*|||
GGAGAAGCAGAGAGTGAAGTGGG
Mismatch:
....A..................
..............T........
...................T...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
22
Number of Mismatches:3
Location:chr19:49897349-49897372
Genomic Sequence:GGAGGAGCTGAGAGGGAAGGGGG
Strand:-
Genomic Region:gene(CCDC155)
3' PAM Orientation:GGAGGAGCTGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||*|||||*||||*|||
GGAGGAGCTGAGAGGGAAGGGGG
Mismatch:
........T..............
..............G........
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
23
Number of Mismatches:3
Location:chr10:93438058-93438081
Genomic Sequence:GGGGGAGCAGAGAGAGAAGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGGGAGCAGAGAGAGAAGCAGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||*|||||||||||*|||||*||
GGGGGAGCAGAGAGAGAAGCAGG
Mismatch:
..G....................
..............A........
....................A..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
24
Number of Mismatches:3
Location:chr1:32928768-32928791
Genomic Sequence:GGAGGAGGAGAGAGGGAAGGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGGAGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*||||*|||
GGAGGAGGAGAGAGGGAAGGGGG
Mismatch:
.......G...............
..............G........
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
25
Number of Mismatches:3
Location:chr19:8018198-8018221
Genomic Sequence:GGAGGAGGAGAGAGGGAAGGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGGAGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*||||*|||
GGAGGAGGAGAGAGGGAAGGGGG
Mismatch:
.......G...............
..............G........
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
26
Number of Mismatches:3
Location:chr15:41164701-41164724
Genomic Sequence:GGAGGAGGAGAGAGGGAAGGGGG
Strand:-
Genomic Region:gene(RHOV)
3' PAM Orientation:GGAGGAGGAGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*||||*|||
GGAGGAGGAGAGAGGGAAGGGGG
Mismatch:
.......G...............
..............G........
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
27
Number of Mismatches:3
Location:chr9:976282-976305
Genomic Sequence:GGAGGAGAAGAGAGAGAAGCGGA
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGAAGAGAGAGAAGCGGA
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*|||||||*
GGAGGAGAAGAGAGAGAAGCGGA
Mismatch:
.......A...............
..............A........
......................A
Distal seed mismatch
Proximal seed mismatch
PAM mismatch
28
Number of Mismatches:3
Location:chr21:44794818-44794841
Genomic Sequence:AGAGGAGCAGAGAGGGAACCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGAGGAGCAGAGAGGGAACCGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
*|||||||||||||*|||*||||
AGAGGAGCAGAGAGGGAACCGGG
Mismatch:
A......................
..............G........
..................C....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
29
Number of Mismatches:3
Location:chr11:59965352-59965375
Genomic Sequence:GGAGGAGGAGAGAGGGAAGGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGGAGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*||||*|||
GGAGGAGGAGAGAGGGAAGGGGG
Mismatch:
.......G...............
..............G........
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
30
Number of Mismatches:3
Location:chr20:12613998-12614021
Genomic Sequence:GGAGGAGGAGAGAGGGAAGGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGGAGAGAGGGAAGGGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||*||||||*||||*|||
GGAGGAGGAGAGAGGGAAGGGGG
Mismatch:
.......G...............
..............G........
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
31
Number of Mismatches:3
Location:chr1:155101397-155101420
Genomic Sequence:GGAGGAGCAGGGAGAGAAGTGGG
Strand:+
Genomic Region:gene(EFNA1)
3' PAM Orientation:GGAGGAGCAGGGAGAGAAGTGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||*|||*||||*|||
GGAGGAGCAGGGAGAGAAGTGGG
Mismatch:
..........G............
..............A........
...................T...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
32
Number of Mismatches:3
Location:chr10:133184898-133184921
Genomic Sequence:GGAGGAGCAGAGGGAGAAGCGGA
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGCAGAGGGAGAAGCGGA
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||*|*|||||||*
GGAGGAGCAGAGGGAGAAGCGGA
Mismatch:
............G..........
..............A........
......................A
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
33
Number of Mismatches:3
Location:chr10:32430181-32430204
Genomic Sequence:GGAGGAGCAGAGATCTAAGAGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGCAGAGATCTAAGAGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||||||||*|*|||*|||
GGAGGAGCAGAGATCTAAGAGGG
Mismatch:
.............T.........
...............T.......
...................A...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
34
Number of Mismatches:3
Location:chr10:6078399-6078422
Genomic Sequence:GGAGGAGCAGAGAGGGATGCGGC
Strand:-
Genomic Region:gene(IL2RA)
3' PAM Orientation:GGAGGAGCAGAGAGGGATGCGGC
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||*||||*
GGAGGAGCAGAGAGGGATGCGGC
Mismatch:
..............G........
.................T.....
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
35
Number of Mismatches:3
Location:chr16:90026481-90026504
Genomic Sequence:GGAGGAGCAGAGAGCCAGGTGGG
Strand:+
Genomic Region:gene(DEF8)
3' PAM Orientation:GGAGGAGCAGAGAGCCAGGTGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
|||||||||||||||*|*|*|||
GGAGGAGCAGAGAGCCAGGTGGG
Mismatch:
...............C.......
.................G.....
...................T...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
36
Number of Mismatches:3
Location:chr16:8960538-8960561
Genomic Sequence:GGAGGAGCAGAGAGAGAGGAGGG
Strand:+
Genomic Region:gene(CARHSP1)
3' PAM Orientation:GGAGGAGCAGAGAGAGAGGAGGG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||*|*|||
GGAGGAGCAGAGAGAGAGGAGGG
Mismatch:
..............A........
.................G.....
...................A...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
37
Number of Mismatches:3
Location:chr8:24564876-24564899
Genomic Sequence:GGAGGAGCAGAGAGAGAAGAGTG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGAGCAGAGAGAGAAGAGTG
Alignment:
GGAGGAGCAGAGAGCGAAGCGGG
||||||||||||||*||||*|*|
GGAGGAGCAGAGAGAGAAGAGTG
Mismatch:
..............A........
...................A...
.....................T.
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132281751
hs0257132312660
hs0257132322761
hs0257132333064
hs0257132354276
hs0257132364377
hs0257132374680
hs0257132385185
hs0257132395286
hs0257132405690
hs0257132426498
hs02571324367101
hs02571324471105
hs02571324572106
hs02571324673107
hs02571324776110
hs02571324877111
hs02571325183117
hs02571325287121

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Cla11845IIIGCGAAGCGAAGGAGGAGCAGAGAGCGAAGCGGG
RlaIVCWGCAGGAGGAGCAGAGAGCGAAGCGGG
Psp0357IIGCGAAGGCGAAGGGAGGAGCAGAGAGCGAAGCGGG
Psp10HIIGRAGCAGGGAGCAGGGAGGAGCAGAGAGCGAAGCGGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments