grID Information

Summary

grID: hs025713227
Sequence (23-mer): AGGAGGAGCAGAGAGCGAAGCGG
grID Score: high (700)
Doench (2014) Score: 0.41078
Doench (2016) Score: 0.63076
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643698-6643676
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537732
NM_014865 NCAPD2chr12660329766411322566
NM_001039670 IFFO1chr12664869366652495017
NM_001193457 IFFO1chr12664869366652495017

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): AGGAGGAGCAGAGAGCGAAG
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 60
GC-score: moderate
Tm (°C): 67.08
Tm score: moderate
RNAfold (dot bracket): .......((.....))....
deltaG (Kcal/mol): -0.50
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 43
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches: 1
Total Genomic Sites With 2 Mismatches: 4
Total Genomic Sites With 3 Mismatches: 37
1chr12:6643675-66436980
CCGCTTCGCTCTCTGCTCCTCCT
|||||||||||||||||||||||
CCGCTTCGCTCTCTGCTCCTCCT
2chr8:144272921-1442729441
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||||||||||
AGGAGGAGGAGAGAGCGAAGCGG
3chr16:1630460-16304832
CCGCTTCGCTCTCTGCTCCTCCT
||||||||||||||**|||||||
CCGCTTCGCTCTCTCGTCCTCCT
4chrX:49524180-495242032
AGGAGGAGCAGAGAGCGAAGCGG
|||||||*||||||||||||*||
AGGAGGAACAGAGAGCGAAGGGG
5chr3:11174761-111747842
AGGAGGAGCAGAGAGCGAAGCGG
*||||||||||||||*|||||||
TGGAGGAGCAGAGAGTGAAGCGG
6chr10:6078400-60784232
CCGCTTCGCTCTCTGCTCCTCCT
||||*||*|||||||||||||||
CCGCATCCCTCTCTGCTCCTCCT
7chr12:13016229-130162523
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGAAGAGAGAGCGAAGGGG
8chr3:186910284-1869103073
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGAAGAGAGAGCGAAGGGG
9chr14:83036372-830363953
CCGCTTCGCTCTCTGCTCCTCCT
||||||*|||||||**|||||||
CCGCTTGGCTCTCTCGTCCTCCT
10chr1:6784292-67843153
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGAAAAGAGAGCGAAGGGG
11chr6:137919577-1379196003
CCGCTTCGCTCTCTGCTCCTCCT
||*|||||||||||**|||||||
CCCCTTCGCTCTCTCGTCCTCCT
12chr15:45326884-453269073
CCGCTTCGCTCTCTGCTCCTCCT
||*||||||||||*||*||||||
CCCCTTCGCTCTCAGCACCTCCT
13chr5:16055461-160554843
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGACGAGAGAGCGAAGTGG
14chr3:19188578-191886013
CCGCTTCGCTCTCTGCTCCTCCT
|||||||*||||||*||||*|||
CCGCTTCCCTCTCTCCTCCACCT
15chr12:132868776-1328687993
CCGCTTCGCTCTCTGCTCCTCCT
|||||*|||||||||||*|*|||
CCGCTACGCTCTCTGCTGCACCT
16chr5:122976928-1229769513
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||*||||||
AGGAGGAAGAGAGAGCAAAGCGG
17chr5:177988981-1779890043
AGGAGGAGCAGAGAGCGAAGCGG
|*||||*||||||||||||||*|
AAGAGGCGCAGAGAGCGAAGCAG
18chr4:126512857-1265128803
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|*||||||||||||
AGGAGGAAGACAGAGCGAAGCGG
19chr7:104156642-1041566653
AGGAGGAGCAGAGAGCGAAGCGG
|||||*||*|*||||||||||||
AGGAGAAGTACAGAGCGAAGCGG
20chr9:976281-9763043
AGGAGGAGCAGAGAGCGAAGCGG
*|||||||*||||||*|||||||
GGGAGGAGAAGAGAGAGAAGCGG
21chr1:43471918-434719413
CCGCTTCGCTCTCTGCTCCTCCT
||*|||*||||||||||||*|||
CCCCTTGGCTCTCTGCTCCACCT
22chr6:160390332-1603903553
CCGCTTCGCTCTCTGCTCCTCCT
||||**||||||||||||||*||
CCGCAACGCTCTCTGCTCCTGCT
23chr13:77396114-773961373
CCGCTTCGCTCTCTGCTCCTCCT
||*||||*||||||||||||*||
CCCCTTCCCTCTCTGCTCCTGCT
24chr4:17424831-174248543
AGGAGGAGCAGAGAGCGAAGCGG
|||||||*||||||||*|||*||
AGGAGGAACAGAGAGCAAAGGGG
25chr6:35369238-353692613
CCGCTTCGCTCTCTGCTCCTCCT
||*|||*|||||||||||||||*
CCCCTTGGCTCTCTGCTCCTCCA
26chr10:133184897-1331849203
AGGAGGAGCAGAGAGCGAAGCGG
*||||||||||||*|*|||||||
GGGAGGAGCAGAGGGAGAAGCGG
27chr3:14302029-143020523
AGGAGGAGCAGAGAGCGAAGCGG
||*||||||||||||*||||*||
AGCAGGAGCAGAGAGAGAAGGGG
28chrX:38284962-382849853
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*|||||||*|||*||
AGGAGGAGTAGAGAGCTAAGAGG
29chr11:59965353-599653763
CCGCTTCGCTCTCTGCTCCTCCT
||*||||*||||||*||||||||
CCCCTTCCCTCTCTCCTCCTCCT
30chr11:73715410-737154333
CCGCTTCGCTCTCTGCTCCTCCT
|*|||||*||||||||||||*||
CGGCTTCCCTCTCTGCTCCTGCT
31chr10:93438057-934380803
AGGAGGAGCAGAGAGCGAAGCGG
|||*|||||||||||*|||||*|
AGGGGGAGCAGAGAGAGAAGCAG
32chr19:47572388-475724113
CCGCTTCGCTCTCTGCTCCTCCT
||*|*|||||||||*||||||||
CCCCATCGCTCTCTCCTCCTCCT
33chr1:32928769-329287923
CCGCTTCGCTCTCTGCTCCTCCT
||*||||*||||||*||||||||
CCCCTTCCCTCTCTCCTCCTCCT
34chr15:41164702-411647253
CCGCTTCGCTCTCTGCTCCTCCT
||*||||*||||||*||||||||
CCCCTTCCCTCTCTCCTCCTCCT
35chr10:22061873-220618963
AGGAGGAGCAGAGAGCGAAGCGG
|||||||*||||||||||*|*||
AGGAGGAACAGAGAGCGAGGGGG
36chr20:12613999-126140223
CCGCTTCGCTCTCTGCTCCTCCT
||*||||*||||||*||||||||
CCCCTTCCCTCTCTCCTCCTCCT
37chr19:8018199-80182223
CCGCTTCGCTCTCTGCTCCTCCT
||*||||*||||||*||||||||
CCCCTTCCCTCTCTCCTCCTCCT
38chr10:133184444-1331844673
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||*||*||*|
AGGAGGAGCAGAGAGAGAGGCAG
39chr1:158029953-1580299763
CCGCTTCGCTCTCTGCTCCTCCT
||*|||**|||||||||||||||
CCCCTTGCCTCTCTGCTCCTCCT
40chr11:24966728-249667513
CCGCTTCGCTCTCTGCTCCTCCT
||||*||**||||||||||||||
CCGCATCCGTCTCTGCTCCTCCT
41chr10:133183666-1331836893
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||**||||*|
AGGAGGAGCAGAGAGAAAAGCAG
42chr16:90026480-900265033
AGGAGGAGCAGAGAGCGAAGCGG
||||||||||||||||*|*|*||
AGGAGGAGCAGAGAGCCAGGTGG
43chr10:32430180-324302033
AGGAGGAGCAGAGAGCGAAGCGG
||||||||||||||*|*|||*||
AGGAGGAGCAGAGATCTAAGAGG
1
Number of Mismatches:0
Location:chr12:6643675-6643698
Genomic Sequence:AGGAGGAGCAGAGAGCGAAGCGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:AGGAGGAGCAGAGAGCGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||||||||||
AGGAGGAGCAGAGAGCGAAGCGG
Mismatch:
2
Number of Mismatches:1
Location:chr8:144272921-144272944
Genomic Sequence:AGGAGGAGGAGAGAGCGAAGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGGAGAGAGCGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||||||||||
AGGAGGAGGAGAGAGCGAAGCGG
Mismatch:
........G..............
Distal seed mismatch
3
Number of Mismatches:2
Location:chr16:1630460-1630483
Genomic Sequence:AGGAGGACGAGAGAGCGAAGCGG
Strand:-
Genomic Region:gene(IFT140)
3' PAM Orientation:AGGAGGACGAGAGAGCGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**||||||||||||||
AGGAGGACGAGAGAGCGAAGCGG
Mismatch:
.......C...............
........G..............
Distal seed mismatch
Distal seed mismatch
4
Number of Mismatches:2
Location:chrX:49524180-49524203
Genomic Sequence:AGGAGGAACAGAGAGCGAAGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAACAGAGAGCGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||*||||||||||||*||
AGGAGGAACAGAGAGCGAAGGGG
Mismatch:
.......A...............
....................G..
Distal seed mismatch
PAM N Offtarget
5
Number of Mismatches:2
Location:chr3:11174761-11174784
Genomic Sequence:TGGAGGAGCAGAGAGTGAAGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:TGGAGGAGCAGAGAGTGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
*||||||||||||||*|||||||
TGGAGGAGCAGAGAGTGAAGCGG
Mismatch:
T......................
...............T.......
Distal mismatch
Proximal seed mismatch
6
Number of Mismatches:2
Location:chr10:6078400-6078423
Genomic Sequence:AGGAGGAGCAGAGAGGGATGCGG
Strand:-
Genomic Region:gene(IL2RA)
3' PAM Orientation:AGGAGGAGCAGAGAGGGATGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||*||*||||
AGGAGGAGCAGAGAGGGATGCGG
Mismatch:
...............G.......
..................T....
Proximal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr12:13016229-13016252
Genomic Sequence:AGGAGGAAGAGAGAGCGAAGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAAGAGAGAGCGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGAAGAGAGAGCGAAGGGG
Mismatch:
.......A...............
........G..............
....................G..
Distal seed mismatch
Distal seed mismatch
PAM N Offtarget
8
Number of Mismatches:3
Location:chr3:186910284-186910307
Genomic Sequence:AGGAGGAAGAGAGAGCGAAGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAAGAGAGAGCGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGAAGAGAGAGCGAAGGGG
Mismatch:
.......A...............
........G..............
....................G..
Distal seed mismatch
Distal seed mismatch
PAM N Offtarget
9
Number of Mismatches:3
Location:chr14:83036372-83036395
Genomic Sequence:AGGAGGACGAGAGAGCCAAGCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGAGGACGAGAGAGCCAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||*||||||
AGGAGGACGAGAGAGCCAAGCGG
Mismatch:
.......C...............
........G..............
................C......
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr1:6784292-6784315
Genomic Sequence:AGGAGGAAAAGAGAGCGAAGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAAAAGAGAGCGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGAAAAGAGAGCGAAGGGG
Mismatch:
.......A...............
........A..............
....................G..
Distal seed mismatch
Distal seed mismatch
PAM N Offtarget
11
Number of Mismatches:3
Location:chr6:137919577-137919600
Genomic Sequence:AGGAGGACGAGAGAGCGAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGAGGACGAGAGAGCGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGACGAGAGAGCGAAGGGG
Mismatch:
.......C...............
........G..............
....................G..
Distal seed mismatch
Distal seed mismatch
PAM N Offtarget
12
Number of Mismatches:3
Location:chr15:45326884-45326907
Genomic Sequence:AGGAGGTGCTGAGAGCGAAGGGG
Strand:-
Genomic Region:gene(SORD)
3' PAM Orientation:AGGAGGTGCTGAGAGCGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||*||*||||||||||*||
AGGAGGTGCTGAGAGCGAAGGGG
Mismatch:
......T................
.........T.............
....................G..
Distal mismatch
Distal seed mismatch
PAM N Offtarget
13
Number of Mismatches:3
Location:chr5:16055461-16055484
Genomic Sequence:AGGAGGACGAGAGAGCGAAGTGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGACGAGAGAGCGAAGTGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||||||*||
AGGAGGACGAGAGAGCGAAGTGG
Mismatch:
.......C...............
........G..............
....................T..
Distal seed mismatch
Distal seed mismatch
PAM N Offtarget
14
Number of Mismatches:3
Location:chr3:19188578-19188601
Genomic Sequence:AGGTGGAGGAGAGAGGGAAGCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGTGGAGGAGAGAGGGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||*||||*||||||*|||||||
AGGTGGAGGAGAGAGGGAAGCGG
Mismatch:
...T...................
........G..............
...............G.......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr12:132868776-132868799
Genomic Sequence:AGGTGCAGCAGAGAGCGTAGCGG
Strand:-
Genomic Region:gene(GALNT9)
3' PAM Orientation:AGGTGCAGCAGAGAGCGTAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||*|*|||||||||||*|||||
AGGTGCAGCAGAGAGCGTAGCGG
Mismatch:
...T...................
.....C.................
.................T.....
Distal mismatch
Distal mismatch
Proximal seed mismatch
16
Number of Mismatches:3
Location:chr5:122976928-122976951
Genomic Sequence:AGGAGGAAGAGAGAGCAAAGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAAGAGAGAGCAAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|||||||*||||||
AGGAGGAAGAGAGAGCAAAGCGG
Mismatch:
.......A...............
........G..............
................A......
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
17
Number of Mismatches:3
Location:chr5:177988981-177989004
Genomic Sequence:AAGAGGCGCAGAGAGCGAAGCAG
Strand:+
Genomic Region:gene(COL23A1)
3' PAM Orientation:AAGAGGCGCAGAGAGCGAAGCAG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|*||||*||||||||||||||*|
AAGAGGCGCAGAGAGCGAAGCAG
Mismatch:
.A.....................
......C................
.....................A.
Distal mismatch
Distal mismatch
PAM mismatch
18
Number of Mismatches:3
Location:chr4:126512857-126512880
Genomic Sequence:AGGAGGAAGACAGAGCGAAGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAAGACAGAGCGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||**|*||||||||||||
AGGAGGAAGACAGAGCGAAGCGG
Mismatch:
.......A...............
........G..............
..........C............
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
19
Number of Mismatches:3
Location:chr7:104156642-104156665
Genomic Sequence:AGGAGAAGTACAGAGCGAAGCGG
Strand:+
Genomic Region:gene(LHFPL3)
3' PAM Orientation:AGGAGAAGTACAGAGCGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||*||*|*||||||||||||
AGGAGAAGTACAGAGCGAAGCGG
Mismatch:
.....A.................
........T..............
..........C............
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
20
Number of Mismatches:3
Location:chr9:976281-976304
Genomic Sequence:GGGAGGAGAAGAGAGAGAAGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGAGGAGAAGAGAGAGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
*|||||||*||||||*|||||||
GGGAGGAGAAGAGAGAGAAGCGG
Mismatch:
G......................
........A..............
...............A.......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
21
Number of Mismatches:3
Location:chr1:43471918-43471941
Genomic Sequence:AGGTGGAGCAGAGAGCCAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGTGGAGCAGAGAGCCAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||*||||||||||||*|||*||
AGGTGGAGCAGAGAGCCAAGGGG
Mismatch:
...T...................
................C......
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
22
Number of Mismatches:3
Location:chr6:160390332-160390355
Genomic Sequence:AGCAGGAGCAGAGAGCGTTGCGG
Strand:-
Genomic Region:exon(NM_000876.exon0)
3' PAM Orientation:AGCAGGAGCAGAGAGCGTTGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||*||||||||||||||**||||
AGCAGGAGCAGAGAGCGTTGCGG
Mismatch:
..C....................
.................T.....
..................T....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
23
Number of Mismatches:3
Location:chr13:77396114-77396137
Genomic Sequence:AGCAGGAGCAGAGAGGGAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGCAGGAGCAGAGAGGGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||*||||||||||||*||||*||
AGCAGGAGCAGAGAGGGAAGGGG
Mismatch:
..C....................
...............G.......
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
24
Number of Mismatches:3
Location:chr4:17424831-17424854
Genomic Sequence:AGGAGGAACAGAGAGCAAAGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAACAGAGAGCAAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||*||||||||*|||*||
AGGAGGAACAGAGAGCAAAGGGG
Mismatch:
.......A...............
................A......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
25
Number of Mismatches:3
Location:chr6:35369238-35369261
Genomic Sequence:TGGAGGAGCAGAGAGCCAAGGGG
Strand:-
Genomic Region:gene(PPARD)
3' PAM Orientation:TGGAGGAGCAGAGAGCCAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
*|||||||||||||||*|||*||
TGGAGGAGCAGAGAGCCAAGGGG
Mismatch:
T......................
................C......
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
26
Number of Mismatches:3
Location:chr10:133184897-133184920
Genomic Sequence:GGGAGGAGCAGAGGGAGAAGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGAGGAGCAGAGGGAGAAGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
*||||||||||||*|*|||||||
GGGAGGAGCAGAGGGAGAAGCGG
Mismatch:
G......................
.............G.........
...............A.......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
27
Number of Mismatches:3
Location:chr3:14302029-14302052
Genomic Sequence:AGCAGGAGCAGAGAGAGAAGGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGCAGGAGCAGAGAGAGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||*||||||||||||*||||*||
AGCAGGAGCAGAGAGAGAAGGGG
Mismatch:
..C....................
...............A.......
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
28
Number of Mismatches:3
Location:chrX:38284962-38284985
Genomic Sequence:AGGAGGAGTAGAGAGCTAAGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGTAGAGAGCTAAGAGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*|||||||*|||*||
AGGAGGAGTAGAGAGCTAAGAGG
Mismatch:
........T..............
................T......
....................A..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
29
Number of Mismatches:3
Location:chr11:59965353-59965376
Genomic Sequence:AGGAGGAGGAGAGAGGGAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGGAGAGAGGGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||*||||*||
AGGAGGAGGAGAGAGGGAAGGGG
Mismatch:
........G..............
...............G.......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
30
Number of Mismatches:3
Location:chr11:73715410-73715433
Genomic Sequence:AGCAGGAGCAGAGAGGGAAGCCG
Strand:-
Genomic Region:gene(UCP3)
3' PAM Orientation:AGCAGGAGCAGAGAGGGAAGCCG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||*||||||||||||*|||||*|
AGCAGGAGCAGAGAGGGAAGCCG
Mismatch:
..C....................
...............G.......
.....................C.
Distal mismatch
Proximal seed mismatch
PAM mismatch
31
Number of Mismatches:3
Location:chr10:93438057-93438080
Genomic Sequence:AGGGGGAGCAGAGAGAGAAGCAG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGGGGAGCAGAGAGAGAAGCAG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||*|||||||||||*|||||*|
AGGGGGAGCAGAGAGAGAAGCAG
Mismatch:
...G...................
...............A.......
.....................A.
Distal mismatch
Proximal seed mismatch
PAM mismatch
32
Number of Mismatches:3
Location:chr19:47572388-47572411
Genomic Sequence:AGGAGGAGGAGAGAGCGATGGGG
Strand:-
Genomic Region:exon(NM_015168.exon13)
3' PAM Orientation:AGGAGGAGGAGAGAGCGATGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*|||||||||*|*||
AGGAGGAGGAGAGAGCGATGGGG
Mismatch:
........G..............
..................T....
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
33
Number of Mismatches:3
Location:chr1:32928769-32928792
Genomic Sequence:AGGAGGAGGAGAGAGGGAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGGAGAGAGGGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||*||||*||
AGGAGGAGGAGAGAGGGAAGGGG
Mismatch:
........G..............
...............G.......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
34
Number of Mismatches:3
Location:chr15:41164702-41164725
Genomic Sequence:AGGAGGAGGAGAGAGGGAAGGGG
Strand:-
Genomic Region:gene(RHOV)
3' PAM Orientation:AGGAGGAGGAGAGAGGGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||*||||*||
AGGAGGAGGAGAGAGGGAAGGGG
Mismatch:
........G..............
...............G.......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
35
Number of Mismatches:3
Location:chr10:22061873-22061896
Genomic Sequence:AGGAGGAACAGAGAGCGAGGGGG
Strand:+
Genomic Region:gene(DNAJC1)
3' PAM Orientation:AGGAGGAACAGAGAGCGAGGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||*||||||||||*|*||
AGGAGGAACAGAGAGCGAGGGGG
Mismatch:
.......A...............
..................G....
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
36
Number of Mismatches:3
Location:chr20:12613999-12614022
Genomic Sequence:AGGAGGAGGAGAGAGGGAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGGAGAGAGGGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||*||||*||
AGGAGGAGGAGAGAGGGAAGGGG
Mismatch:
........G..............
...............G.......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
37
Number of Mismatches:3
Location:chr19:8018199-8018222
Genomic Sequence:AGGAGGAGGAGAGAGGGAAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGGAGAGAGGGAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||*||||||*||||*||
AGGAGGAGGAGAGAGGGAAGGGG
Mismatch:
........G..............
...............G.......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
38
Number of Mismatches:3
Location:chr10:133184444-133184467
Genomic Sequence:AGGAGGAGCAGAGAGAGAGGCAG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGCAGAGAGAGAGGCAG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||*||*||*|
AGGAGGAGCAGAGAGAGAGGCAG
Mismatch:
...............A.......
..................G....
.....................A.
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
39
Number of Mismatches:3
Location:chr1:158029953-158029976
Genomic Sequence:AGGAGGAGCAGAGAGGCAAGGGG
Strand:-
Genomic Region:gene(KIRREL)
3' PAM Orientation:AGGAGGAGCAGAGAGGCAAGGGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||**|||*||
AGGAGGAGCAGAGAGGCAAGGGG
Mismatch:
...............G.......
................C......
....................G..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
40
Number of Mismatches:3
Location:chr11:24966728-24966751
Genomic Sequence:AGGAGGAGCAGAGACGGATGCGG
Strand:-
Genomic Region:gene(LUZP2)
3' PAM Orientation:AGGAGGAGCAGAGACGGATGCGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||||||||**||*||||
AGGAGGAGCAGAGACGGATGCGG
Mismatch:
..............C........
...............G.......
..................T....
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
41
Number of Mismatches:3
Location:chr10:133183666-133183689
Genomic Sequence:AGGAGGAGCAGAGAGAAAAGCAG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGCAGAGAGAAAAGCAG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
|||||||||||||||**||||*|
AGGAGGAGCAGAGAGAAAAGCAG
Mismatch:
...............A.......
................A......
.....................A.
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
42
Number of Mismatches:3
Location:chr16:90026480-90026503
Genomic Sequence:AGGAGGAGCAGAGAGCCAGGTGG
Strand:+
Genomic Region:gene(DEF8)
3' PAM Orientation:AGGAGGAGCAGAGAGCCAGGTGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||||||||||*|*|*||
AGGAGGAGCAGAGAGCCAGGTGG
Mismatch:
................C......
..................G....
....................T..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
43
Number of Mismatches:3
Location:chr10:32430180-32430203
Genomic Sequence:AGGAGGAGCAGAGATCTAAGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGAGGAGCAGAGATCTAAGAGG
Alignment:
AGGAGGAGCAGAGAGCGAAGCGG
||||||||||||||*|*|||*||
AGGAGGAGCAGAGATCTAAGAGG
Mismatch:
..............T........
................T......
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132281650
hs0257132312559
hs0257132322660
hs0257132332963
hs0257132354175
hs0257132364276
hs0257132374579
hs0257132385084
hs0257132395185
hs0257132405589
hs0257132426397
hs02571324366100
hs02571324470104
hs02571324571105
hs02571324672106
hs02571324775109
hs02571324876110
hs02571325182116
hs02571325286120

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Cla11845IIIGCGAAGCGAAAGGAGGAGCAGAGAGCGAAGCGG
Psp0357IIGCGAAGGCGAAGAGGAGGAGCAGAGAGCGAAGCGG
RlaIVCWGCAAGGAGGAGCAGAGAGCGAAGCGG
Psp10HIIGRAGCAGGGAGCAGAGGAGGAGCAGAGAGCGAAGCGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments