grID Information

Summary

grID: hs025713228
Sequence (23-mer): GCATCTTCTTTTGCGTCGCCAGG
grID Score: high (1000)
Doench (2014) Score: 0.38791
Doench (2016) Score: 0.43991
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643714-6643736
Strand: +
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537672
NM_014865 NCAPD2chr12660329766411322582
NM_001039670 IFFO1chr12664869366652494957
NM_001193457 IFFO1chr12664869366652494957

Browser View

Sequence Analysis

Target Sequence (RNA): GCAUCUUCUUUUGCGUCGCC
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: yes
Pol III Terminator: yes

Thermodynamic Properties

GC-content (%): 55
GC-score: moderate
Tm (°C): 42.06
Tm score: very low
RNAfold (dot bracket): (((........)))......
deltaG (Kcal/mol): -2.50
Predicted Folding: low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 2
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 2
1chr12:6643713-66437360
GCATCTTCTTTTGCGTCGCCAGG
|||||||||||||||||||||||
GCATCTTCTTTTGCGTCGCCAGG
2chrX:39647412-396474353
CCTGGCGACGCAAAAGAAGATGC
*|||*|||*||||||||||||||
GCTGCCGAGGCAAAAGAAGATGC
3chr2:50789299-507893223
GCATCTTCTTTTGCGTCGCCAGG
|||||||||||||*|||*||||*
GCATCTTCTTTTGTGTCTCCAGC
1
Number of Mismatches:0
Location:chr12:6643713-6643736
Genomic Sequence:GCATCTTCTTTTGCGTCGCCAGG
Strand:+
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GCATCTTCTTTTGCGTCGCCAGG
Alignment:
GCATCTTCTTTTGCGTCGCCAGG
|||||||||||||||||||||||
GCATCTTCTTTTGCGTCGCCAGG
Mismatch:
2
Number of Mismatches:3
Location:chrX:39647412-39647435
Genomic Sequence:GCATCTTCTTTTGCCTCGGCAGC
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GCATCTTCTTTTGCCTCGGCAGC
Alignment:
GCATCTTCTTTTGCGTCGCCAGG
||||||||||||||*|||*|||*
GCATCTTCTTTTGCCTCGGCAGC
Mismatch:
..............C........
..................G....
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
3
Number of Mismatches:3
Location:chr2:50789299-50789322
Genomic Sequence:GCATCTTCTTTTGTGTCTCCAGC
Strand:+
Genomic Region:gene(NRXN1)
3' PAM Orientation:GCATCTTCTTTTGTGTCTCCAGC
Alignment:
GCATCTTCTTTTGCGTCGCCAGG
|||||||||||||*|||*||||*
GCATCTTCTTTTGTGTCTCCAGC
Mismatch:
.............T.........
.................T.....
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713230-430
hs025713229-133
hs0257132271650
hs0257132261751
hs0257132252054
hs0257132242660
hs0257132232761
hs0257132224680
hs0257132214781
hs0257132204882
hs0257132194983
hs0257132185488
hs0257132175791
hs0257132166195
hs0257132156498
hs02571321472106
hs02571321290124

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
RlaIVCWGCAGCATCTTCTTTTGCGTCGCCAGG
RlaIVCWCCAGCATCTTCTTTTGCGTCGCCAGG
RflFIIICGCCAGCGCCAGGCATCTTCTTTTGCGTCGCCAGG
Hpy99ICGWCGCGTCGGCATCTTCTTTTGCGTCGCCAGG
EcoRIICCWGGCCAGGGCATCTTCTTTTGCGTCGCCAGG
PsuGIBBCGDTGCGTGCATCTTCTTTTGCGTCGCCAGG
ScrFICCNGGCCAGGGCATCTTCTTTTGCGTCGCCAGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs52791852666437146643715+CCC/Tsinglenear-gene-5,untranslated-5
rs55118006766437176643718+CCC/Tsinglenear-gene-5,untranslated-5
rs319997966437196643720+TTC/Tsinglenear-gene-5,untranslated-5
rs1154933266437206643721+CCC/Tsinglenear-gene-5,untranslated-5
rs53776608666437266643727+CCC/Tsinglenear-gene-5,untranslated-5

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA contains a potential pol III terminator sequence.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments