grID Information

Summary

grID: hs025713229
Sequence (23-mer): GCGGCTGACTGTCGAACAGGAGG
grID Score: high (700)
Doench (2014) Score: 0.13921
Doench (2016) Score: 0.62884
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643715-6643693
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537715
NM_014865 NCAPD2chr12660329766411322583
NM_001039670 IFFO1chr12664869366652495000
NM_001193457 IFFO1chr12664869366652495000

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GCGGCUGACUGUCGAACAGG
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 65
GC-score: high
Tm (°C): 60.99
Tm score: moderate
RNAfold (dot bracket): .((((.....))))......
deltaG (Kcal/mol): -4.20
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 12
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches: 1
Total Genomic Sites With 2 Mismatches: 2
Total Genomic Sites With 3 Mismatches: 8
1chr12:6643692-66437150
CCTCCTGTTCGACAGTCAGCCGC
|||||||||||||||||||||||
CCTCCTGTTCGACAGTCAGCCGC
2chrX:39647433-396474561
GCGGCTGACTGTCGAACAGGAGG
||||||||||||*||||||||||
GCGGCTGACTGTAGAACAGGAGG
3chr15:64821908-648219312
GCGGCTGACTGTCGAACAGGAGG
|*|||||*|||||||||||||||
GTGGCTGTCTGTCGAACAGGAGG
4chr15:64920803-649208262
GCGGCTGACTGTCGAACAGGAGG
|||||||*||||*||||||||||
GCGGCTGTCTGTAGAACAGGAGG
5chr22:41070493-410705163
GCGGCTGACTGTCGAACAGGAGG
||*||||*|*|||||||||||||
GCAGCTGTCAGTCGAACAGGAGG
6chr1:215044015-2150440383
CCTCCTGTTCGACAGTCAGCCGC
||||||*||||||||*|||||*|
CCTCCTCTTCGACAGACAGCCCC
7chr5:159378543-1593785663
GCGGCTGACTGTCGAACAGGAGG
||*||||*|||||||||*|||||
GCAGCTGTCTGTCGAACGGGAGG
8chr13:29880853-298808763
CCTCCTGTTCGACAGTCAGCCGC
*||||||||||||||*|||||*|
GCTCCTGTTCGACAGACAGCCCC
9chr6:80663766-806637893
GCGGCTGACTGTCGAACAGGAGG
||*||||*|||||*|||||||||
GCAGCTGTCTGTCAAACAGGAGG
10chr5:173940243-1739402663
CCTCCTGTTCGACAGTCAGCCGC
|||||*|||||||||*|||||*|
CCTCCAGTTCGACAGACAGCCCC
11chr16:28252015-282520383
GCGGCTGACTGTCGAACAGGAGG
|||||||*||||||||**|||||
GCGGCTGTCTGTCGAATGGGAGG
12chr19:47061826-470618493
CCTCCTGTTCGACAGTCAGCCGC
|||||*||||*||||*|||||||
CCTCCAGTTCCACAGACAGCCGC
1
Number of Mismatches:0
Location:chr12:6643692-6643715
Genomic Sequence:GCGGCTGACTGTCGAACAGGAGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GCGGCTGACTGTCGAACAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|||||||||||||||||||||||
GCGGCTGACTGTCGAACAGGAGG
Mismatch:
2
Number of Mismatches:1
Location:chrX:39647433-39647456
Genomic Sequence:GCGGCTGACTGTAGAACAGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GCGGCTGACTGTAGAACAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
||||||||||||*||||||||||
GCGGCTGACTGTAGAACAGGAGG
Mismatch:
............A..........
Proximal seed mismatch
3
Number of Mismatches:2
Location:chr15:64821908-64821931
Genomic Sequence:GTGGCTGTCTGTCGAACAGGAGG
Strand:+
Genomic Region:gene(ZNF609)
3' PAM Orientation:GTGGCTGTCTGTCGAACAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|*|||||*|||||||||||||||
GTGGCTGTCTGTCGAACAGGAGG
Mismatch:
.T.....................
.......T...............
Distal mismatch
Distal seed mismatch
4
Number of Mismatches:2
Location:chr15:64920803-64920826
Genomic Sequence:GCGGCTGTCTGTAGAACAGGAGG
Strand:+
Genomic Region:gene(ZNF609)
3' PAM Orientation:GCGGCTGTCTGTAGAACAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|||||||*||||*||||||||||
GCGGCTGTCTGTAGAACAGGAGG
Mismatch:
.......T...............
............A..........
Distal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr22:41070493-41070516
Genomic Sequence:GCAGCTGTCAGTCGAACAGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GCAGCTGTCAGTCGAACAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
||*||||*|*|||||||||||||
GCAGCTGTCAGTCGAACAGGAGG
Mismatch:
..A....................
.......T...............
.........A.............
Distal mismatch
Distal seed mismatch
Distal seed mismatch
6
Number of Mismatches:3
Location:chr1:215044015-215044038
Genomic Sequence:GGGGCTGTCTGTCGAAGAGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGGGCTGTCTGTCGAAGAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|*|||||*||||||||*||||||
GGGGCTGTCTGTCGAAGAGGAGG
Mismatch:
.G.....................
.......T...............
................G......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr5:159378543-159378566
Genomic Sequence:GCAGCTGTCTGTCGAACGGGAGG
Strand:+
Genomic Region:gene(ADRA1B)
3' PAM Orientation:GCAGCTGTCTGTCGAACGGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
||*||||*|||||||||*|||||
GCAGCTGTCTGTCGAACGGGAGG
Mismatch:
..A....................
.......T...............
.................G.....
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr13:29880853-29880876
Genomic Sequence:GGGGCTGTCTGTCGAACAGGAGC
Strand:-
Genomic Region:gene(MTUS2)
3' PAM Orientation:GGGGCTGTCTGTCGAACAGGAGC
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|*|||||*||||||||||||||*
GGGGCTGTCTGTCGAACAGGAGC
Mismatch:
.G.....................
.......T...............
......................C
Distal mismatch
Distal seed mismatch
PAM mismatch
9
Number of Mismatches:3
Location:chr6:80663766-80663789
Genomic Sequence:GCAGCTGTCTGTCAAACAGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GCAGCTGTCTGTCAAACAGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
||*||||*|||||*|||||||||
GCAGCTGTCTGTCAAACAGGAGG
Mismatch:
..A....................
.......T...............
.............A.........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr5:173940243-173940266
Genomic Sequence:GGGGCTGTCTGTCGAACTGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGGGCTGTCTGTCGAACTGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|*|||||*|||||||||*|||||
GGGGCTGTCTGTCGAACTGGAGG
Mismatch:
.G.....................
.......T...............
.................T.....
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr16:28252015-28252038
Genomic Sequence:GCGGCTGTCTGTCGAATGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GCGGCTGTCTGTCGAATGGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|||||||*||||||||**|||||
GCGGCTGTCTGTCGAATGGGAGG
Mismatch:
.......T...............
................T......
.................G.....
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chr19:47061826-47061849
Genomic Sequence:GCGGCTGTCTGTGGAACTGGAGG
Strand:-
Genomic Region:gene(PPP5D1)
3' PAM Orientation:GCGGCTGTCTGTGGAACTGGAGG
Alignment:
GCGGCTGACTGTCGAACAGGAGG
|||||||*||||*||||*|||||
GCGGCTGTCTGTGGAACTGGAGG
Mismatch:
.......T...............
............G..........
.................T.....
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713228-133
hs025713231842
hs025713232943
hs0257132331246
hs0257132352458
hs0257132362559
hs0257132372862
hs0257132383367
hs0257132393468
hs0257132403872
hs0257132424680
hs0257132434983
hs0257132445387
hs0257132455488
hs0257132465589
hs0257132475892
hs0257132485993
hs0257132516599
hs02571325269103
hs02571325489123
hs02571325590124
hs02571325691125
hs02571325794128
hs02571325895129
hs025713259100134

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
PsuGIBBCGDGTCGAGCGGCTGACTGTCGAACAGGAGG
TaqITCGATCGAGCGGCTGACTGTCGAACAGGAGG
RlaIVCWGCTGCGGCTGACTGTCGAACAGGAGG
RlaIVCWACTGCGGCTGACTGTCGAACAGGAGG
RlaIVCWACAGCGGCTGACTGTCGAACAGGAGG
TauIGCSGCGCGGCGCGGCTGACTGTCGAACAGGAGG
BisIGCNGCGCGGCGCGGCTGACTGTCGAACAGGAGG
CviJIRGCYGGCTGCGGCTGACTGTCGAACAGGAGG
OspHL35IIIYAGGAGCAGGAGGCGGCTGACTGTCGAACAGGAGG
Tsp4CIACNGTACTGTGCGGCTGACTGTCGAACAGGAGG
Fnu4HIGCNGCGCGGCGCGGCTGACTGTCGAACAGGAGG

SNPs and Variation

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments