grID Information

Summary

grID: hs025713230
Sequence (23-mer): GATGCGGCTGACTGTCGAACAGG
grID Score: high (700)
Doench (2014) Score: 0.09586
Doench (2016) Score: 0.46257
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643718-6643696
Strand: -
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537712
NM_014865 NCAPD2chr12660329766411322586
NM_001039670 IFFO1chr12664869366652494997
NM_001193457 IFFO1chr12664869366652494997

DNase I hypersensitive sites from ENCODE

DNase I hypersensitivity region:chr12:6643560-6643710
Numbers of Cell Types:123
Cell Types:8988t, A549, AG04449, AG04450, AG09309, AG09319, AG10803, Adult_CD4_Th0, AoAF, AoSMC, BE2_C, BJ, Caco-2, CD14+, CD20+, CD34+_Mobilized, CMK, Chorion, Cll, HSMM_emb, Fibrobl, Fibrop, GM06990, GM12864, GM12865, GM12878, Gliobla, Gm12891, Gm12892, Gm18507, Gm19238, Gm19239, Gm19240, H9es, HAEpiC, HAc, HA-h, HBMEC, HCF, HCFaa, HCM, HCPEpiC, HCT-116, HConF, HEEpiC, H1-hESC, HFF, HFF-Myc, HGF, HIPEpiC, HL-60, HMEC, HMF, HMVEC-LBl, HMVEC-LLy, HMVEC-dAd, HMVEC-dBl-Ad, HMVEC-dBl-Neo, HMVEC-dLy-Ad, HMVEC-dLy-Neo, HMVEC-dNeo, HNPCEpiC, HPAEC, HPAF, HPF, HPdLF, HRCEpiC, HRE, HRGEC, HRPEpiC, HSMM, HSMM_FSHD, HUVEC, HVMF, HeLa-S3, HeLa-S3s3Ifna4h, HepG2, Hepatocytes, HPDE6-E6E7, HTR8svn, Huh-7, Huh-7.5, Ips, Ishikawa, Ishikawa, Jurkat, K562, LNCap, LNCaP, MCF-7, MCF-7, Medullo, Melano, Myometr, NB4, NH-A, NHDF-Ad, NHDF-neo, NHEK, NHLF, NT2-D1, Osteobl, PanIsletD, Panislets, Phte, PrEC, Progfib, RPTEC, RWPE1, SAEC, SK-N-SH, SK-N-MC, SkMC, Stellate, T-47D, Urothelia, UrotheliaUt189, WERI-Rb-1, WI-38, WI-38_TAM, H1-hESC, Th1, Th2,

Browser View

Sequence Analysis

Target Sequence (RNA): GAUGCGGCUGACUGUCGAAC
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 60
GC-score: moderate
Tm (°C): 58.63
Tm score: moderate
RNAfold (dot bracket): ....((((.....))))...
deltaG (Kcal/mol): -4.20
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 13
Total Genomic Sites With 0 Mismatches: 1
Total Genomic Sites With 1 Mismatches: 1
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 11
1chr12:6643695-66437180
CCTGTTCGACAGTCAGCCGCATC
|||||||||||||||||||||||
CCTGTTCGACAGTCAGCCGCATC
2chrX:39647430-396474531
GATGCGGCTGACTGTCGAACAGG
|||||||||||||||*|||||||
GATGCGGCTGACTGTAGAACAGG
3chr13:29880856-298808793
CCTGTTCGACAGTCAGCCGCATC
||||||||||||*|||||*|||*
CCTGTTCGACAGACAGCCCCATG
4chr15:64821905-648219283
GATGCGGCTGACTGTCGAACAGG
*|||*|||||*||||||||||||
TATGTGGCTGTCTGTCGAACAGG
5chr6:80663763-806637863
GATGCGGCTGACTGTCGAACAGG
|||||*||||*|||||*||||||
GATGCAGCTGTCTGTCAAACAGG
6chr5:159378540-1593785633
GATGCGGCTGACTGTCGAACAGG
|||||*||||*|||||||||*||
GATGCAGCTGTCTGTCGAACGGG
7chr5:173940246-1739402693
CCTGTTCGACAGTCAGCCGCATC
||*|||||||||*|||||*||||
CCAGTTCGACAGACAGCCCCATC
8chr1:215044018-2150440413
CCTGTTCGACAGTCAGCCGCATC
|||*||||||||*|||||*||||
CCTCTTCGACAGACAGCCCCATC
9chr22:41070490-410705133
GATGCGGCTGACTGTCGAACAGG
|||||*||||*|*||||||||||
GATGCAGCTGTCAGTCGAACAGG
10chr15:64920800-649208233
GATGCGGCTGACTGTCGAACAGG
*|||||||||*||||*|||||||
TATGCGGCTGTCTGTAGAACAGG
11chr19:47061829-470618523
CCTGTTCGACAGTCAGCCGCATC
||*||||*||||*||||||||||
CCAGTTCCACAGACAGCCGCATC
12chr1:120102432-1201024553
GATGCGGCTGACTGTCGAACAGG
||||||||||*||||||||**||
GATGCGGCTGTCTGTCGAATGGG
13chr16:28252012-282520353
GATGCGGCTGACTGTCGAACAGG
||||||||||*||||||||**||
GATGCGGCTGTCTGTCGAATGGG
1
Number of Mismatches:0
Location:chr12:6643695-6643718
Genomic Sequence:GATGCGGCTGACTGTCGAACAGG
Strand:-
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:GATGCGGCTGACTGTCGAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
|||||||||||||||||||||||
GATGCGGCTGACTGTCGAACAGG
Mismatch:
2
Number of Mismatches:1
Location:chrX:39647430-39647453
Genomic Sequence:GATGCGGCTGACTGTAGAACAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATGCGGCTGACTGTAGAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
|||||||||||||||*|||||||
GATGCGGCTGACTGTAGAACAGG
Mismatch:
...............A.......
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr13:29880856-29880879
Genomic Sequence:CATGGGGCTGTCTGTCGAACAGG
Strand:-
Genomic Region:gene(MTUS2)
3' PAM Orientation:CATGGGGCTGTCTGTCGAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
*|||*|||||*||||||||||||
CATGGGGCTGTCTGTCGAACAGG
Mismatch:
C......................
....G..................
..........T............
Distal mismatch
Distal mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr15:64821905-64821928
Genomic Sequence:TATGTGGCTGTCTGTCGAACAGG
Strand:+
Genomic Region:gene(ZNF609)
3' PAM Orientation:TATGTGGCTGTCTGTCGAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
*|||*|||||*||||||||||||
TATGTGGCTGTCTGTCGAACAGG
Mismatch:
T......................
....T..................
..........T............
Distal mismatch
Distal mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr6:80663763-80663786
Genomic Sequence:GATGCAGCTGTCTGTCAAACAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATGCAGCTGTCTGTCAAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
|||||*||||*|||||*||||||
GATGCAGCTGTCTGTCAAACAGG
Mismatch:
.....A.................
..........T............
................A......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr5:159378540-159378563
Genomic Sequence:GATGCAGCTGTCTGTCGAACGGG
Strand:+
Genomic Region:gene(ADRA1B)
3' PAM Orientation:GATGCAGCTGTCTGTCGAACGGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
|||||*||||*|||||||||*||
GATGCAGCTGTCTGTCGAACGGG
Mismatch:
.....A.................
..........T............
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
7
Number of Mismatches:3
Location:chr5:173940246-173940269
Genomic Sequence:GATGGGGCTGTCTGTCGAACTGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GATGGGGCTGTCTGTCGAACTGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
||||*|||||*|||||||||*||
GATGGGGCTGTCTGTCGAACTGG
Mismatch:
....G..................
..........T............
....................T..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
8
Number of Mismatches:3
Location:chr1:215044018-215044041
Genomic Sequence:GATGGGGCTGTCTGTCGAAGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GATGGGGCTGTCTGTCGAAGAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
||||*|||||*||||||||*|||
GATGGGGCTGTCTGTCGAAGAGG
Mismatch:
....G..................
..........T............
...................G...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr22:41070490-41070513
Genomic Sequence:GATGCAGCTGTCAGTCGAACAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATGCAGCTGTCAGTCGAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
|||||*||||*|*||||||||||
GATGCAGCTGTCAGTCGAACAGG
Mismatch:
.....A.................
..........T............
............A..........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr15:64920800-64920823
Genomic Sequence:TATGCGGCTGTCTGTAGAACAGG
Strand:+
Genomic Region:gene(ZNF609)
3' PAM Orientation:TATGCGGCTGTCTGTAGAACAGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
*|||||||||*||||*|||||||
TATGCGGCTGTCTGTAGAACAGG
Mismatch:
T......................
..........T............
...............A.......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr19:47061829-47061852
Genomic Sequence:GATGCGGCTGTCTGTGGAACTGG
Strand:-
Genomic Region:gene(PPP5D1)
3' PAM Orientation:GATGCGGCTGTCTGTGGAACTGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
||||||||||*||||*||||*||
GATGCGGCTGTCTGTGGAACTGG
Mismatch:
..........T............
...............G.......
....................T..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
12
Number of Mismatches:3
Location:chr1:120102432-120102455
Genomic Sequence:GATGCGGCTGTCTGTCGAATGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATGCGGCTGTCTGTCGAATGGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
||||||||||*||||||||**||
GATGCGGCTGTCTGTCGAATGGG
Mismatch:
..........T............
...................T...
....................G..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
13
Number of Mismatches:3
Location:chr16:28252012-28252035
Genomic Sequence:GATGCGGCTGTCTGTCGAATGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATGCGGCTGTCTGTCGAATGGG
Alignment:
GATGCGGCTGACTGTCGAACAGG
||||||||||*||||||||**||
GATGCGGCTGTCTGTCGAATGGG
Mismatch:
..........T............
...................T...
....................G..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713228-430
hs025713231539
hs025713232640
hs025713233943
hs0257132352155
hs0257132362256
hs0257132372559
hs0257132383064
hs0257132393165
hs0257132403569
hs0257132424377
hs0257132434680
hs0257132445084
hs0257132455185
hs0257132465286
hs0257132475589
hs0257132485690
hs0257132516296
hs02571325266100
hs02571325486120
hs02571325587121
hs02571325688122
hs02571325791125
hs02571325892126
hs02571325997131
hs02571326098132

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Tsp4CIACNGTACTGTGATGCGGCTGACTGTCGAACAGG
TaqITCGATCGAGATGCGGCTGACTGTCGAACAGG
BisIGCNGCGCGGCGATGCGGCTGACTGTCGAACAGG
TauIGCSGCGCGGCGATGCGGCTGACTGTCGAACAGG
RlaIVCWGCTGATGCGGCTGACTGTCGAACAGG
RlaIVCWACTGATGCGGCTGACTGTCGAACAGG
RlaIVCWACAGATGCGGCTGACTGTCGAACAGG
PsuGIBBCGDTGCGGGATGCGGCTGACTGTCGAACAGG
PsuGIBBCGDGTCGAGATGCGGCTGACTGTCGAACAGG
Fnu4HIGCNGCGCGGCGATGCGGCTGACTGTCGAACAGG
CviJIRGCYGGCTGATGCGGCTGACTGTCGAACAGG

SNPs and Variation

Notes

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments