grID Information

Summary

grID: hs025713231
Sequence (23-mer): TTTGCGTCGCCAGGTGAAGACGG
grID Score: high (700)
Doench (2014) Score: 0.42647
Doench (2016) Score: 0.47882
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643723-6643745
Strand: +
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537663
NM_014865 NCAPD2chr12660329766411322591
NM_001039670 IFFO1chr12664869366652494948
NM_001193457 IFFO1chr12664869366652494948

Browser View

Sequence Analysis

Target Sequence (RNA): UUUGCGUCGCCAGGUGAAGA
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 55
GC-score: moderate
Tm (°C): 50.74
Tm score: low
RNAfold (dot bracket): ......((((...))))...
deltaG (Kcal/mol): -1.50
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 0
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches:
1chr12:6643722-66437450
TTTGCGTCGCCAGGTGAAGACGG
|||||||||||||||||||||||
TTTGCGTCGCCAGGTGAAGACGG
1
Number of Mismatches:0
Location:chr12:6643722-6643745
Genomic Sequence:TTTGCGTCGCCAGGTGAAGACGG
Strand:+
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:TTTGCGTCGCCAGGTGAAGACGG
Alignment:
TTTGCGTCGCCAGGTGAAGACGG
|||||||||||||||||||||||
TTTGCGTCGCCAGGTGAAGACGG
Mismatch:

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713230539
hs025713229842
hs0257132272559
hs0257132262660
hs0257132252963
hs0257132243569
hs0257132233670
hs0257132225589
hs0257132215690
hs0257132205791
hs0257132195892
hs0257132186397
hs02571321766100
hs02571321670104
hs02571321573107
hs02571321481115
hs02571321299133

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
RlaIVCWCCATTTGCGTCGCCAGGTGAAGACGG
RflFIIICGCCAGCGCCAGTTTGCGTCGCCAGGTGAAGACGG
SetIASSTAGGTTTTGCGTCGCCAGGTGAAGACGG
EcoRIICCWGGCCAGGTTTGCGTCGCCAGGTGAAGACGG
PsuGIBBCGDTGCGTTTTGCGTCGCCAGGTGAAGACGG
ScrFICCNGGCCAGGTTTGCGTCGCCAGGTGAAGACGG
Hpy99ICGWCGCGTCGTTTGCGTCGCCAGGTGAAGACGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs53776608666437266643727+CCC/Tsinglenear-gene-5,untranslated-5

Notes

× Warning! This gRNA has the potential for more than 25 offtargets in the genome.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments