grID Information

Summary

grID: hs025713232
Sequence (23-mer): TTGCGTCGCCAGGTGAAGACGGG
grID Score: high (700)
Doench (2014) Score: 0.19677
Doench (2016) Score: 0.48392
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643724-6643746
Strand: +
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537662
NM_014865 NCAPD2chr12660329766411322592
NM_001039670 IFFO1chr12664869366652494947
NM_001193457 IFFO1chr12664869366652494947

Browser View

Sequence Analysis

Target Sequence (RNA): UUGCGUCGCCAGGUGAAGAC
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 60
GC-score: moderate
Tm (°C): 56.08
Tm score: moderate
RNAfold (dot bracket): .....((((...))))....
deltaG (Kcal/mol): -1.50
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 0
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches:
1chr12:6643723-66437460
TTGCGTCGCCAGGTGAAGACGGG
|||||||||||||||||||||||
TTGCGTCGCCAGGTGAAGACGGG
1
Number of Mismatches:0
Location:chr12:6643723-6643746
Genomic Sequence:TTGCGTCGCCAGGTGAAGACGGG
Strand:+
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:TTGCGTCGCCAGGTGAAGACGGG
Alignment:
TTGCGTCGCCAGGTGAAGACGGG
|||||||||||||||||||||||
TTGCGTCGCCAGGTGAAGACGGG
Mismatch:

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713230640
hs025713229943
hs0257132272660
hs0257132262761
hs0257132253064
hs0257132243670
hs0257132233771
hs0257132225690
hs0257132215791
hs0257132205892
hs0257132195993
hs0257132186498
hs02571321767101
hs02571321671105
hs02571321574108
hs02571321482116
hs025713212100134

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
SetIASSTAGGTTTGCGTCGCCAGGTGAAGACGGG
PsuGIBBCGDTGCGTTTGCGTCGCCAGGTGAAGACGGG
Hpy99ICGWCGCGTCGTTGCGTCGCCAGGTGAAGACGGG
ScrFICCNGGCCAGGTTGCGTCGCCAGGTGAAGACGGG
RlaIVCWCCATTGCGTCGCCAGGTGAAGACGGG
RflFIIICGCCAGCGCCAGTTGCGTCGCCAGGTGAAGACGGG
EcoRIICCWGGCCAGGTTGCGTCGCCAGGTGAAGACGGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs53776608666437266643727+CCC/Tsinglenear-gene-5,untranslated-5

Notes

× Warning! This gRNA has the potential for more than 25 offtargets in the genome.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments