grID Information

Summary

grID: hs025713233
Sequence (23-mer): CGTCGCCAGGTGAAGACGGGCGG
grID Score: moderate (600)
Doench (2014) Score: 0.55234
Doench (2016) Score: 0.64026
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643727-6643749
Strand: +
gRNA location: exon:refGene(NM_002046.exon0)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537659
NM_014865 NCAPD2chr12660329766411322595
NM_001039670 IFFO1chr12664869366652494944
NM_001193457 IFFO1chr12664869366652494944

Browser View

Sequence Analysis

Target Sequence (RNA): CGUCGCCAGGUGAAGACGGG
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 70
GC-score: high
Tm (°C): 59.46
Tm score: moderate
RNAfold (dot bracket): ((((..........))))..
deltaG (Kcal/mol): -4.50
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 0
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches:
1chr12:6643726-66437490
CGTCGCCAGGTGAAGACGGGCGG
|||||||||||||||||||||||
CGTCGCCAGGTGAAGACGGGCGG
1
Number of Mismatches:0
Location:chr12:6643726-6643749
Genomic Sequence:CGTCGCCAGGTGAAGACGGGCGG
Strand:+
Genomic Region:exon(NM_002046.exon0)
3' PAM Orientation:CGTCGCCAGGTGAAGACGGGCGG
Alignment:
CGTCGCCAGGTGAAGACGGGCGG
|||||||||||||||||||||||
CGTCGCCAGGTGAAGACGGGCGG
Mismatch:

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713234-727
hs025713230943
hs0257132291246
hs0257132272963
hs0257132263064
hs0257132253367
hs0257132243973
hs0257132234074
hs0257132225993
hs0257132216094
hs0257132206195
hs0257132196296
hs02571321867101
hs02571321770104
hs02571321674108
hs02571321577111
hs02571321485119

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
EcoRIICCWGGCCAGGCGTCGCCAGGTGAAGACGGGCGG
RlaIVCWCCACGTCGCCAGGTGAAGACGGGCGG
Hpy99ICGWCGCGTCGCGTCGCCAGGTGAAGACGGGCGG
PsuGIBBCGDGGCGGCGTCGCCAGGTGAAGACGGGCGG
SetIASSTAGGTCGTCGCCAGGTGAAGACGGGCGG
ScrFICCNGGCCAGGCGTCGCCAGGTGAAGACGGGCGG
RflFIIICGCCAGCGCCAGCGTCGCCAGGTGAAGACGGGCGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has the potential for more than 25 offtargets in the genome.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments