grID Information

Summary

grID: hs025713235
Sequence (23-mer): AAGACGGGCGGAGAGAAACCCGG
grID Score: high (800)
Doench (2014) Score: 0.18250
Doench (2016) Score: 0.51379
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643739-6643761
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537647
NM_014865 NCAPD2chr12660329766411322607
NM_001039670 IFFO1chr12664869366652494932
NM_001193457 IFFO1chr12664869366652494932

Browser View

Sequence Analysis

Target Sequence (RNA): AAGACGGGCGGAGAGAAACC
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 60
GC-score: moderate
Tm (°C): 66.45
Tm score: moderate
RNAfold (dot bracket): ....................
deltaG (Kcal/mol): 0.00
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 1
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 1
1chr12:6643738-66437610
AAGACGGGCGGAGAGAAACCCGG
|||||||||||||||||||||||
AAGACGGGCGGAGAGAAACCCGG
2chr3:65583266-655832893
CCGGGTTTCTCTCCGCCCGTCTT
|||||||||||*||||||*||*|
CCGGGTTTCTCACCGCCCCTCAT
1
Number of Mismatches:0
Location:chr12:6643738-6643761
Genomic Sequence:AAGACGGGCGGAGAGAAACCCGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:AAGACGGGCGGAGAGAAACCCGG
Alignment:
AAGACGGGCGGAGAGAAACCCGG
|||||||||||||||||||||||
AAGACGGGCGGAGAGAAACCCGG
Mismatch:
2
Number of Mismatches:3
Location:chr3:65583266-65583289
Genomic Sequence:ATGAGGGGCGGTGAGAAACCCGG
Strand:-
Genomic Region:gene(MAGI1)
3' PAM Orientation:ATGAGGGGCGGTGAGAAACCCGG
Alignment:
AAGACGGGCGGAGAGAAACCCGG
|*||*||||||*|||||||||||
ATGAGGGGCGGTGAGAAACCCGG
Mismatch:
.T.....................
....G..................
...........T...........
Distal mismatch
Distal mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713234539
hs0257132302155
hs0257132292458
hs0257132274175
hs0257132264276
hs0257132254579
hs0257132245185
hs0257132235286
hs02571322271105
hs02571322172106
hs02571322073107
hs02571321974108
hs02571321879113
hs02571321782116
hs02571321686120
hs02571321589123
hs02571321497131

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
CauIICCSGGCCCGGAAGACGGGCGGAGAGAAACCCGG
PsuGIBBCGDGGCGGAAGACGGGCGGAGAGAAACCCGG
PsuGIBBCGDCCCGGAAGACGGGCGGAGAGAAACCCGG
HpaIICCGGCCGGAAGACGGGCGGAGAGAAACCCGG
ScrFICCNGGCCCGGAAGACGGGCGGAGAGAAACCCGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments