grID Information

Summary

grID: hs025713236
Sequence (23-mer): AGACGGGCGGAGAGAAACCCGGG
grID Score: high (700)
Doench (2014) Score: 0.42443
Doench (2016) Score: 0.54603
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643740-6643762
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537646
NM_014865 NCAPD2chr12660329766411322608
NM_001039670 IFFO1chr12664869366652494931
NM_001193457 IFFO1chr12664869366652494931

Browser View

Sequence Analysis

Target Sequence (RNA): AGACGGGCGGAGAGAAACCC
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 65
GC-score: high
Tm (°C): 68.60
Tm score: moderate
RNAfold (dot bracket): ....(((..........)))
deltaG (Kcal/mol): -1.50
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 1
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 1
1chr12:6643739-66437620
AGACGGGCGGAGAGAAACCCGGG
|||||||||||||||||||||||
AGACGGGCGGAGAGAAACCCGGG
2chr20:43028928-430289513
AGACGGGCGGAGAGAAACCCGGG
|||||||*||||||||||**|||
AGACGGGTGGAGAGAAACAGGGG
1
Number of Mismatches:0
Location:chr12:6643739-6643762
Genomic Sequence:AGACGGGCGGAGAGAAACCCGGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:AGACGGGCGGAGAGAAACCCGGG
Alignment:
AGACGGGCGGAGAGAAACCCGGG
|||||||||||||||||||||||
AGACGGGCGGAGAGAAACCCGGG
Mismatch:
2
Number of Mismatches:3
Location:chr20:43028928-43028951
Genomic Sequence:AGACGGGTGGAGAGAAACAGGGG
Strand:+
Genomic Region:gene(HNF4A)
3' PAM Orientation:AGACGGGTGGAGAGAAACAGGGG
Alignment:
AGACGGGCGGAGAGAAACCCGGG
|||||||*||||||||||**|||
AGACGGGTGGAGAGAAACAGGGG
Mismatch:
.......T...............
..................A....
...................G...
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713234640
hs0257132302256
hs0257132292559
hs0257132274276
hs0257132264377
hs0257132254680
hs0257132245286
hs0257132235387
hs02571322272106
hs02571322173107
hs02571322074108
hs02571321975109
hs02571321880114
hs02571321783117
hs02571321687121
hs02571321590124
hs02571321498132

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
CauIICCSGGCCCGGAGACGGGCGGAGAGAAACCCGGG
SecICCNNGGCCCGGGAGACGGGCGGAGAGAAACCCGGG
AvaICYCGRGCCCGGGAGACGGGCGGAGAGAAACCCGGG
PsuGIBBCGDGGCGGAGACGGGCGGAGAGAAACCCGGG
PsuGIBBCGDCCCGGAGACGGGCGGAGAGAAACCCGGG
HpaIICCGGCCGGAGACGGGCGGAGAGAAACCCGGG
SmaICCCGGGCCCGGGAGACGGGCGGAGAGAAACCCGGG
ScrFICCNGGCCCGGAGACGGGCGGAGAGAAACCCGGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments