grID Information

Summary

grID: hs025713237
Sequence (23-mer): CGGGCGGAGAGAAACCCGGGAGG
grID Score: moderate (600)
Doench (2014) Score: 0.32661
Doench (2016) Score: 0.76636
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643743-6643765
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537643
NM_014865 NCAPD2chr12660329766411322611
NM_001039670 IFFO1chr12664869366652494928
NM_001193457 IFFO1chr12664869366652494928

Browser View

Sequence Analysis

Target Sequence (RNA): CGGGCGGAGAGAAACCCGGG
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 75
GC-score: high
Tm (°C): 66.78
Tm score: moderate
RNAfold (dot bracket): ((((..........))))..
deltaG (Kcal/mol): -5.30
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 8
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 8
1chr12:6643742-66437650
CGGGCGGAGAGAAACCCGGGAGG
|||||||||||||||||||||||
CGGGCGGAGAGAAACCCGGGAGG
2chr20:19192490-191925133
CGGGCGGAGAGAAACCCGGGAGG
*||||*|||*|||||||||||||
GGGGCAGAGGGAAACCCGGGAGG
3chr1:5490419-54904423
CCTCCCGGGTTTCTCTCCGCCCG
||||||||||*|||||||*||*|
CCTCCCGGGTATCTCTCCCCCGG
4chr1:207600746-2076007693
CGGGCGGAGAGAAACCCGGGAGG
*||||*|||||||||||*|||||
AGGGCAGAGAGAAACCCAGGAGG
5chr9:136474350-1364743733
CGGGCGGAGAGAAACCCGGGAGG
||||||**|||||*|||||||||
CGGGCGCTGAGAAGCCCGGGAGG
6chr14:55032722-550327453
CCTCCCGGGTTTCTCTCCGCCCG
||*||||||||*||||||*||||
CCACCCGGGTTACTCTCCCCCCG
7chr19:45946830-459468533
CGGGCGGAGAGAAACCCGGGAGG
*||||||||||*||||||||||*
GGGGCGGAGAGGAACCCGGGAGT
8chr11:62105231-621052543
CGGGCGGAGAGAAACCCGGGAGG
*||||||||||*|||*|||||||
GGGGCGGAGAGGAACGCGGGAGG
9chr20:61425628-614256513
CGGGCGGAGAGAAACCCGGGAGG
*||||||||||||*||||*||||
GGGGCGGAGAGAAGCCCGTGAGG
1
Number of Mismatches:0
Location:chr12:6643742-6643765
Genomic Sequence:CGGGCGGAGAGAAACCCGGGAGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:CGGGCGGAGAGAAACCCGGGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
|||||||||||||||||||||||
CGGGCGGAGAGAAACCCGGGAGG
Mismatch:
2
Number of Mismatches:3
Location:chr20:19192490-19192513
Genomic Sequence:GGGGCAGAGGGAAACCCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGGCAGAGGGAAACCCGGGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
*||||*|||*|||||||||||||
GGGGCAGAGGGAAACCCGGGAGG
Mismatch:
G......................
.....A.................
.........G.............
Distal mismatch
Distal mismatch
Distal seed mismatch
3
Number of Mismatches:3
Location:chr1:5490419-5490442
Genomic Sequence:CCGGGGGAGAGATACCCGGGAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CCGGGGGAGAGATACCCGGGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
|*||*|||||||*||||||||||
CCGGGGGAGAGATACCCGGGAGG
Mismatch:
.C.....................
....G..................
............T..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr1:207600746-207600769
Genomic Sequence:AGGGCAGAGAGAAACCCAGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGGGCAGAGAGAAACCCAGGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
*||||*|||||||||||*|||||
AGGGCAGAGAGAAACCCAGGAGG
Mismatch:
A......................
.....A.................
.................A.....
Distal mismatch
Distal mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr9:136474350-136474373
Genomic Sequence:CGGGCGCTGAGAAGCCCGGGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGGCGCTGAGAAGCCCGGGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
||||||**|||||*|||||||||
CGGGCGCTGAGAAGCCCGGGAGG
Mismatch:
......C................
.......T...............
.............G.........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr14:55032722-55032745
Genomic Sequence:CGGGGGGAGAGTAACCCGGGTGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGGGGGGAGAGTAACCCGGGTGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
||||*||||||*||||||||*||
CGGGGGGAGAGTAACCCGGGTGG
Mismatch:
....G..................
...........T...........
....................T..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
7
Number of Mismatches:3
Location:chr19:45946830-45946853
Genomic Sequence:GGGGCGGAGAGGAACCCGGGAGT
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGGCGGAGAGGAACCCGGGAGT
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
*||||||||||*||||||||||*
GGGGCGGAGAGGAACCCGGGAGT
Mismatch:
G......................
...........G...........
......................T
Distal mismatch
Proximal seed mismatch
PAM mismatch
8
Number of Mismatches:3
Location:chr11:62105231-62105254
Genomic Sequence:GGGGCGGAGAGGAACGCGGGAGG
Strand:+
Genomic Region:gene(ASRGL1)
3' PAM Orientation:GGGGCGGAGAGGAACGCGGGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
*||||||||||*|||*|||||||
GGGGCGGAGAGGAACGCGGGAGG
Mismatch:
G......................
...........G...........
...............G.......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr20:61425628-61425651
Genomic Sequence:GGGGCGGAGAGAAGCCCGTGAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGGCGGAGAGAAGCCCGTGAGG
Alignment:
CGGGCGGAGAGAAACCCGGGAGG
*||||||||||||*||||*||||
GGGGCGGAGAGAAGCCCGTGAGG
Mismatch:
G......................
.............G.........
..................T....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713234943
hs0257132302559
hs0257132292862
hs0257132274579
hs0257132264680
hs0257132254983
hs0257132245589
hs0257132235690
hs02571322275109
hs02571322176110
hs02571322077111
hs02571321978112
hs02571321883117
hs02571321786120
hs02571321690124
hs02571321593127

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
PsuGIBBCGDGGCGGCGGGCGGAGAGAAACCCGGGAGG
PsuGIBBCGDCCCGGCGGGCGGAGAGAAACCCGGGAGG
HpaIICCGGCCGGCGGGCGGAGAGAAACCCGGGAGG
CauIICCSGGCCCGGCGGGCGGAGAGAAACCCGGGAGG
ScrFICCNGGCCCGGCGGGCGGAGAGAAACCCGGGAGG
SecICCNNGGCCCGGGCGGGCGGAGAGAAACCCGGGAGG
SmaICCCGGGCCCGGGCGGGCGGAGAGAAACCCGGGAGG
AvaICYCGRGCCCGGGCGGGCGGAGAGAAACCCGGGAGG
Pdi8503IIICCGGNAGCCGGGAGCGGGCGGAGAGAAACCCGGGAGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments