grID Information

Summary

grID: hs025713238
Sequence (23-mer): GGAGAGAAACCCGGGAGGCTAGG
grID Score: high (800)
Doench (2014) Score: 0.02667
Doench (2016) Score: 0.40917
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643748-6643770
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537638
NM_014865 NCAPD2chr12660329766411322616
NM_001039670 IFFO1chr12664869366652494923
NM_001193457 IFFO1chr12664869366652494923

Browser View

Sequence Analysis

Target Sequence (RNA): GGAGAGAAACCCGGGAGGCU
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 65
GC-score: high
Tm (°C): 69.52
Tm score: high
RNAfold (dot bracket): ..........((....))..
deltaG (Kcal/mol): -1.10
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 8
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 8
1chr12:6643747-66437700
GGAGAGAAACCCGGGAGGCTAGG
|||||||||||||||||||||||
GGAGAGAAACCCGGGAGGCTAGG
2chr4:60105794-601058173
CCTAGCCTCCCGGGTTTCTCTCC
||*|||||||||||||||**|||
CCAAGCCTCCCGGGTTTCAGTCC
3chr2:176946304-1769463273
CCTAGCCTCCCGGGTTTCTCTCC
||||*||||||||*|*|||||||
CCTACCCTCCCGGCTATCTCTCC
4chr10:7328234-73282573
GGAGAGAAACCCGGGAGGCTAGG
*||||||||||*|*|||||||||
AGAGAGAAACCAGTGAGGCTAGG
5chr6:5451026-54510493
CCTAGCCTCCCGGGTTTCTCTCC
|||*||||||*|||||||*||||
CCTTGCCTCCGGGGTTTCACTCC
6chr20:4215531-42155543
GGAGAGAAACCCGGGAGGCTAGG
|||||||*||||||||*|*||||
GGAGAGACACCCGGGAAGTTAGG
7chr19:17194799-171948223
GGAGAGAAACCCGGGAGGCTAGG
|||||||||*|*|*|||||||||
GGAGAGAAATCAGAGAGGCTAGG
8chr5:93511939-935119623
CCTAGCCTCCCGGGTTTCTCTCC
|||*|||||||*||||||||||*
CCTTGCCTCCCCGGTTTCTCTCG
9chr11:32066875-320668983
CCTAGCCTCCCGGGTTTCTCTCC
|||*||||||*|*||||||||||
CCTTGCCTCCGGCGTTTCTCTCC
1
Number of Mismatches:0
Location:chr12:6643747-6643770
Genomic Sequence:GGAGAGAAACCCGGGAGGCTAGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:GGAGAGAAACCCGGGAGGCTAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
|||||||||||||||||||||||
GGAGAGAAACCCGGGAGGCTAGG
Mismatch:
2
Number of Mismatches:3
Location:chr4:60105794-60105817
Genomic Sequence:GGACTGAAACCCGGGAGGCTTGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGACTGAAACCCGGGAGGCTTGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
|||**|||||||||||||||*||
GGACTGAAACCCGGGAGGCTTGG
Mismatch:
...C...................
....T..................
....................T..
Distal mismatch
Distal mismatch
PAM N Offtarget
3
Number of Mismatches:3
Location:chr2:176946304-176946327
Genomic Sequence:GGAGAGATAGCCGGGAGGGTAGG
Strand:-
Genomic Region:gene(EVX2)
3' PAM Orientation:GGAGAGATAGCCGGGAGGGTAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
|||||||*|*||||||||*||||
GGAGAGATAGCCGGGAGGGTAGG
Mismatch:
.......T...............
.........G.............
..................G....
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr10:7328234-7328257
Genomic Sequence:AGAGAGAAACCAGTGAGGCTAGG
Strand:+
Genomic Region:gene(SFMBT2)
3' PAM Orientation:AGAGAGAAACCAGTGAGGCTAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
*||||||||||*|*|||||||||
AGAGAGAAACCAGTGAGGCTAGG
Mismatch:
A......................
...........A...........
.............T.........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr6:5451026-5451049
Genomic Sequence:GGAGTGAAACCCCGGAGGCAAGG
Strand:-
Genomic Region:gene(FARS2)
3' PAM Orientation:GGAGTGAAACCCCGGAGGCAAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
||||*|||||||*||||||*|||
GGAGTGAAACCCCGGAGGCAAGG
Mismatch:
....T..................
............C..........
...................A...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr20:4215531-4215554
Genomic Sequence:GGAGAGACACCCGGGAAGTTAGG
Strand:+
Genomic Region:gene(ADRA1D)
3' PAM Orientation:GGAGAGACACCCGGGAAGTTAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
|||||||*||||||||*|*||||
GGAGAGACACCCGGGAAGTTAGG
Mismatch:
.......C...............
................A......
..................T....
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr19:17194799-17194822
Genomic Sequence:GGAGAGAAATCAGAGAGGCTAGG
Strand:+
Genomic Region:gene(MYO9B)
3' PAM Orientation:GGAGAGAAATCAGAGAGGCTAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
|||||||||*|*|*|||||||||
GGAGAGAAATCAGAGAGGCTAGG
Mismatch:
.........T.............
...........A...........
.............A.........
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr5:93511939-93511962
Genomic Sequence:CGAGAGAAACCGGGGAGGCAAGG
Strand:-
Genomic Region:gene(KIAA0825)
3' PAM Orientation:CGAGAGAAACCGGGGAGGCAAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
*||||||||||*|||||||*|||
CGAGAGAAACCGGGGAGGCAAGG
Mismatch:
C......................
...........G...........
...................A...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr11:32066875-32066898
Genomic Sequence:GGAGAGAAACGCCGGAGGCAAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGAGAAACGCCGGAGGCAAGG
Alignment:
GGAGAGAAACCCGGGAGGCTAGG
||||||||||*|*||||||*|||
GGAGAGAAACGCCGGAGGCAAGG
Mismatch:
..........G............
............C..........
...................A...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713241-628
hs0257132341448
hs0257132303064
hs0257132293367
hs0257132275084
hs0257132265185
hs0257132255488
hs0257132246094
hs0257132236195
hs02571322280114
hs02571322181115
hs02571322082116
hs02571321983117
hs02571321888122
hs02571321791125
hs02571321695129
hs02571321598132

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
CauIICCSGGCCCGGGGAGAGAAACCCGGGAGGCTAGG
PsuGIBBCGDCCCGGGGAGAGAAACCCGGGAGGCTAGG
ScrFICCNGGCCCGGGGAGAGAAACCCGGGAGGCTAGG
AvaICYCGRGCCCGGGGGAGAGAAACCCGGGAGGCTAGG
MaeICTAGCTAGGGAGAGAAACCCGGGAGGCTAGG
SecICCNNGGCCCGGGGGAGAGAAACCCGGGAGGCTAGG
RlaIVCWGCTGGAGAGAAACCCGGGAGGCTAGG
Pdi8503IIICCGGNAGCCGGGAGGGAGAGAAACCCGGGAGGCTAGG
Csp2014IGGAGGCGGAGGCGGAGAGAAACCCGGGAGGCTAGG
CviJIRGCYGGCTGGAGAGAAACCCGGGAGGCTAGG
HpaIICCGGCCGGGGAGAGAAACCCGGGAGGCTAGG
SmaICCCGGGCCCGGGGGAGAGAAACCCGGGAGGCTAGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments