grID Information

Summary

grID: hs025713239
Sequence (23-mer): GAGAGAAACCCGGGAGGCTAGGG
grID Score: high (800)
Doench (2014) Score: 0.26119
Doench (2016) Score: 0.42444
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643749-6643771
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537637
NM_014865 NCAPD2chr12660329766411322617
NM_001039670 IFFO1chr12664869366652494922
NM_001193457 IFFO1chr12664869366652494922

Browser View

Sequence Analysis

Target Sequence (RNA): GAGAGAAACCCGGGAGGCUA
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 60
GC-score: moderate
Tm (°C): 65.56
Tm score: moderate
RNAfold (dot bracket): .........((....))...
deltaG (Kcal/mol): -1.10
Predicted Folding: very low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 5
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches: 1
Total Genomic Sites With 3 Mismatches: 4
1chr12:6643748-66437710
GAGAGAAACCCGGGAGGCTAGGG
|||||||||||||||||||||||
GAGAGAAACCCGGGAGGCTAGGG
2chr10:7328235-73282582
GAGAGAAACCCGGGAGGCTAGGG
||||||||||*|*||||||||||
GAGAGAAACCAGTGAGGCTAGGG
3chr2:67155816-671558393
CCCTAGCCTCCCGGGTTTCTCTC
|||||||||*|*||*||||||||
CCCTAGCCTGCGGGCTTTCTCTC
4chr19:5952059-59520823
GAGAGAAACCCGGGAGGCTAGGG
|*||||||||*|||||||*||||
GGGAGAAACCAGGGAGGCCAGGG
5chr5:93511938-935119613
CCCTAGCCTCCCGGGTTTCTCTC
*|||*|||||||*||||||||||
GCCTTGCCTCCCCGGTTTCTCTC
6chr7:131994513-1319945363
GAGAGAAACCCGGGAGGCTAGGG
|||||||||||||||**|*||||
GAGAGAAACCCGGGAATCCAGGG
1
Number of Mismatches:0
Location:chr12:6643748-6643771
Genomic Sequence:GAGAGAAACCCGGGAGGCTAGGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:GAGAGAAACCCGGGAGGCTAGGG
Alignment:
GAGAGAAACCCGGGAGGCTAGGG
|||||||||||||||||||||||
GAGAGAAACCCGGGAGGCTAGGG
Mismatch:
2
Number of Mismatches:2
Location:chr10:7328235-7328258
Genomic Sequence:GAGAGAAACCAGTGAGGCTAGGG
Strand:+
Genomic Region:gene(SFMBT2)
3' PAM Orientation:GAGAGAAACCAGTGAGGCTAGGG
Alignment:
GAGAGAAACCCGGGAGGCTAGGG
||||||||||*|*||||||||||
GAGAGAAACCAGTGAGGCTAGGG
Mismatch:
..........A............
............T..........
Proximal seed mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr2:67155816-67155839
Genomic Sequence:GAGAGAAAGCCCGCAGGCTAGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GAGAGAAAGCCCGCAGGCTAGGG
Alignment:
GAGAGAAACCCGGGAGGCTAGGG
||||||||*||*|*|||||||||
GAGAGAAAGCCCGCAGGCTAGGG
Mismatch:
........G..............
...........C...........
.............C.........
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr19:5952059-5952082
Genomic Sequence:GGGAGAAACCAGGGAGGCCAGGG
Strand:+
Genomic Region:gene(RANBP3)
3' PAM Orientation:GGGAGAAACCAGGGAGGCCAGGG
Alignment:
GAGAGAAACCCGGGAGGCTAGGG
|*||||||||*|||||||*||||
GGGAGAAACCAGGGAGGCCAGGG
Mismatch:
.G.....................
..........A............
..................C....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr5:93511938-93511961
Genomic Sequence:GAGAGAAACCGGGGAGGCAAGGC
Strand:-
Genomic Region:gene(KIAA0825)
3' PAM Orientation:GAGAGAAACCGGGGAGGCAAGGC
Alignment:
GAGAGAAACCCGGGAGGCTAGGG
||||||||||*|||||||*|||*
GAGAGAAACCGGGGAGGCAAGGC
Mismatch:
..........G............
..................A....
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
6
Number of Mismatches:3
Location:chr7:131994513-131994536
Genomic Sequence:GAGAGAAACCCGGGAATCCAGGG
Strand:+
Genomic Region:gene(PLXNA4)
3' PAM Orientation:GAGAGAAACCCGGGAATCCAGGG
Alignment:
GAGAGAAACCCGGGAGGCTAGGG
|||||||||||||||**|*||||
GAGAGAAACCCGGGAATCCAGGG
Mismatch:
...............A.......
................T......
..................C....
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713241-529
hs0257132341549
hs0257132303165
hs0257132293468
hs0257132275185
hs0257132265286
hs0257132255589
hs0257132246195
hs0257132236296
hs02571322281115
hs02571322182116
hs02571322083117
hs02571321984118
hs02571321889123
hs02571321792126
hs02571321696130
hs02571321599133

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
CauIICCSGGCCCGGGAGAGAAACCCGGGAGGCTAGGG
Csp2014IGGAGGCGGAGGCGAGAGAAACCCGGGAGGCTAGGG
AvaICYCGRGCCCGGGGAGAGAAACCCGGGAGGCTAGGG
PsuGIBBCGDCCCGGGAGAGAAACCCGGGAGGCTAGGG
RlaIVCWGCTGAGAGAAACCCGGGAGGCTAGGG
MaeICTAGCTAGGAGAGAAACCCGGGAGGCTAGGG
HpaIICCGGCCGGGAGAGAAACCCGGGAGGCTAGGG
ScrFICCNGGCCCGGGAGAGAAACCCGGGAGGCTAGGG
SecICCNNGGCCCGGGGAGAGAAACCCGGGAGGCTAGGG
SmaICCCGGGCCCGGGGAGAGAAACCCGGGAGGCTAGGG
CviJIRGCYGGCTGAGAGAAACCCGGGAGGCTAGGG
Pdi8503IIICCGGNAGCCGGGAGGAGAGAAACCCGGGAGGCTAGGG

SNPs and Variation

Notes

× Warning! This gRNA contains a dinucleotide repeat sequence which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments