grID Information

Summary

grID: hs025713240
Sequence (23-mer): GAAACCCGGGAGGCTAGGGACGG
grID Score: high (700)
Doench (2014) Score: 0.12292
Doench (2016) Score: 0.60832
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643753-6643775
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537633
NM_014865 NCAPD2chr12660329766411322621
NM_001039670 IFFO1chr12664869366652494918
NM_001193457 IFFO1chr12664869366652494918

Browser View

Sequence Analysis

Target Sequence (RNA): GAAACCCGGGAGGCUAGGGA
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 65
GC-score: high
Tm (°C): 68.30
Tm score: moderate
RNAfold (dot bracket): ....(((((....)).))).
deltaG (Kcal/mol): -4.40
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 6
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 6
1chr12:6643752-66437750
GAAACCCGGGAGGCTAGGGACGG
|||||||||||||||||||||||
GAAACCCGGGAGGCTAGGGACGG
2chr9:39027436-390274593
CCGTCCCTAGCCTCCCGGGTTTC
||*||||||||||||||*||*||
CCCTCCCTAGCCTCCCGCGTATC
3chr9:40075265-400752883
GAAACCCGGGAGGCTAGGGACGG
||*||*||||||||||||||*||
GATACTCGGGAGGCTAGGGAAGG
4chr9:40384002-403840253
GAAACCCGGGAGGCTAGGGACGG
||*||*||||||||||||||*||
GATACTCGGGAGGCTAGGGAAGG
5chr15:101601761-1016017843
GAAACCCGGGAGGCTAGGGACGG
||*||||*||||||||||||||*
GAGACCCAGGAGGCTAGGGACGT
6chr21:46222167-462221903
CCGTCCCTAGCCTCCCGGGTTTC
|||||||*||||**|||||||||
CCGTCCCAAGCCAGCCGGGTTTC
7chr4:37978731-379787543
CCGTCCCTAGCCTCCCGGGTTTC
*||||||*|||||||*|||||||
GCGTCCCAAGCCTCCGGGGTTTC
1
Number of Mismatches:0
Location:chr12:6643752-6643775
Genomic Sequence:GAAACCCGGGAGGCTAGGGACGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:GAAACCCGGGAGGCTAGGGACGG
Alignment:
GAAACCCGGGAGGCTAGGGACGG
|||||||||||||||||||||||
GAAACCCGGGAGGCTAGGGACGG
Mismatch:
2
Number of Mismatches:3
Location:chr9:39027436-39027459
Genomic Sequence:GATACGCGGGAGGCTAGGGAGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GATACGCGGGAGGCTAGGGAGGG
Alignment:
GAAACCCGGGAGGCTAGGGACGG
||*||*||||||||||||||*||
GATACGCGGGAGGCTAGGGAGGG
Mismatch:
..T....................
.....G.................
....................G..
Distal mismatch
Distal mismatch
PAM N Offtarget
3
Number of Mismatches:3
Location:chr9:40075265-40075288
Genomic Sequence:GATACTCGGGAGGCTAGGGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATACTCGGGAGGCTAGGGAAGG
Alignment:
GAAACCCGGGAGGCTAGGGACGG
||*||*||||||||||||||*||
GATACTCGGGAGGCTAGGGAAGG
Mismatch:
..T....................
.....T.................
....................A..
Distal mismatch
Distal mismatch
PAM N Offtarget
4
Number of Mismatches:3
Location:chr9:40384002-40384025
Genomic Sequence:GATACTCGGGAGGCTAGGGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GATACTCGGGAGGCTAGGGAAGG
Alignment:
GAAACCCGGGAGGCTAGGGACGG
||*||*||||||||||||||*||
GATACTCGGGAGGCTAGGGAAGG
Mismatch:
..T....................
.....T.................
....................A..
Distal mismatch
Distal mismatch
PAM N Offtarget
5
Number of Mismatches:3
Location:chr15:101601761-101601784
Genomic Sequence:GAGACCCAGGAGGCTAGGGACGT
Strand:+
Genomic Region:gene(LRRK1)
3' PAM Orientation:GAGACCCAGGAGGCTAGGGACGT
Alignment:
GAAACCCGGGAGGCTAGGGACGG
||*||||*||||||||||||||*
GAGACCCAGGAGGCTAGGGACGT
Mismatch:
..G....................
.......A...............
......................T
Distal mismatch
Distal seed mismatch
PAM mismatch
6
Number of Mismatches:3
Location:chr21:46222167-46222190
Genomic Sequence:GAAACCCGGCTGGCTTGGGACGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GAAACCCGGCTGGCTTGGGACGG
Alignment:
GAAACCCGGGAGGCTAGGGACGG
|||||||||**||||*|||||||
GAAACCCGGCTGGCTTGGGACGG
Mismatch:
.........C.............
..........T............
...............T.......
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr4:37978731-37978754
Genomic Sequence:GAAACCCCGGAGGCTTGGGACGC
Strand:-
Genomic Region:gene(TBC1D1)
3' PAM Orientation:GAAACCCCGGAGGCTTGGGACGC
Alignment:
GAAACCCGGGAGGCTAGGGACGG
|||||||*|||||||*||||||*
GAAACCCCGGAGGCTTGGGACGC
Mismatch:
.......C...............
...............T.......
......................C
Distal seed mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713241-133
hs0257132341953
hs0257132303569
hs0257132293872
hs0257132275589
hs0257132265690
hs0257132255993
hs0257132246599
hs02571322366100
hs02571322285119
hs02571322186120
hs02571322087121
hs02571321988122
hs02571321893127
hs02571321796130
hs025713216100134

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
SecICCNNGGCCCGGGGAAACCCGGGAGGCTAGGGACGG
CviJIRGCYGGCTGAAACCCGGGAGGCTAGGGACGG
Pdi8503IIICCGGNAGCCGGGAGGAAACCCGGGAGGCTAGGGACGG
MaeICTAGCTAGGAAACCCGGGAGGCTAGGGACGG
ScrFICCNGGCCCGGGAAACCCGGGAGGCTAGGGACGG
CauIICCSGGCCCGGGAAACCCGGGAGGCTAGGGACGG
FinIGGGACGGGACGAAACCCGGGAGGCTAGGGACGG
RlaIVCWGCTGAAACCCGGGAGGCTAGGGACGG
SmaICCCGGGCCCGGGGAAACCCGGGAGGCTAGGGACGG
AvaICYCGRGCCCGGGGAAACCCGGGAGGCTAGGGACGG
Csp2014IGGAGGCGGAGGCGAAACCCGGGAGGCTAGGGACGG
PsuGIBBCGDCCCGGGAAACCCGGGAGGCTAGGGACGG
HpaIICCGGCCGGGAAACCCGGGAGGCTAGGGACGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs18440711666437726643773+CCC/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments