grID Information

Summary

grID: hs025713242
Sequence (23-mer): GGAGGCTAGGGACGGCCTGAAGG
grID Score: moderate (600)
Doench (2014) Score: 0.15647
Doench (2016) Score: 0.46843
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643761-6643783
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537625
NM_014865 NCAPD2chr12660329766411322629
NM_001039670 IFFO1chr12664869366652494910
NM_001193457 IFFO1chr12664869366652494910

Browser View

Sequence Analysis

Target Sequence (RNA): GGAGGCUAGGGACGGCCUGA
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 70
GC-score: high
Tm (°C): 70.67
Tm score: high
RNAfold (dot bracket): ..(((((......)))))..
deltaG (Kcal/mol): -6.10
Predicted Folding: high secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 14
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 14
1chr12:6643760-66437830
GGAGGCTAGGGACGGCCTGAAGG
|||||||||||||||||||||||
GGAGGCTAGGGACGGCCTGAAGG
2chr11:119417606-1194176293
GGAGGCTAGGGACGGCCTGAAGG
**||||*||||||||||||||||
TCAGGCCAGGGACGGCCTGAAGG
3chr9:74090039-740900623
CCTTCAGGCCGTCCCTAGCCTCC
|||*|||||||||||*|||||*|
CCTACAGGCCGTCCCAAGCCTGC
4chr15:88384790-883848133
CCTTCAGGCCGTCCCTAGCCTCC
||||||||||*|||||*|||||*
CCTTCAGGCCCTCCCTTGCCTCG
5chr14:95285572-952855953
CCTTCAGGCCGTCCCTAGCCTCC
||||||||||*|||||*|||||*
CCTTCAGGCCCTCCCTTGCCTCG
6chr7:87959859-879598823
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
7chr13:110057111-1100571343
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
8chr6:34425968-344259913
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
9chr4:80219007-802190303
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
10chr3:132101803-1321018263
CCTTCAGGCCGTCCCTAGCCTCC
||||||||||*||||||||||**
CCTTCAGGCCCTCCCTAGCCTGG
11chr2:24059826-240598493
CCTTCAGGCCGTCCCTAGCCTCC
||||||||||*||||||||||**
CCTTCAGGCCCTCCCTAGCCTGG
12chr4:88619036-886190593
CCTTCAGGCCGTCCCTAGCCTCC
||||||||||*||||||||||**
CCTTCAGGCCCTCCCTAGCCTGG
13chr10:97389027-973890503
GGAGGCTAGGGACGGCCTGAAGG
|||||||*|||||*|*|||||||
GGAGGCTGGGGACTGGCTGAAGG
14chr5:133417743-1334177663
GGAGGCTAGGGACGGCCTGAAGG
|||||*||||||*|||*||||||
GGAGGGTAGGGAGGGCATGAAGG
15chr7:158830855-1588308783
CCTTCAGGCCGTCCCTAGCCTCC
|||*|||||*||||||*||||||
CCTACAGGCGGTCCCTTGCCTCC
1
Number of Mismatches:0
Location:chr12:6643760-6643783
Genomic Sequence:GGAGGCTAGGGACGGCCTGAAGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:GGAGGCTAGGGACGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
|||||||||||||||||||||||
GGAGGCTAGGGACGGCCTGAAGG
Mismatch:
2
Number of Mismatches:3
Location:chr11:119417606-119417629
Genomic Sequence:TCAGGCCAGGGACGGCCTGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:TCAGGCCAGGGACGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||*||||||||||||||||
TCAGGCCAGGGACGGCCTGAAGG
Mismatch:
T......................
.C.....................
......C................
Distal mismatch
Distal mismatch
Distal mismatch
3
Number of Mismatches:3
Location:chr9:74090039-74090062
Genomic Sequence:GCAGGCTTGGGACGGCCTGTAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GCAGGCTTGGGACGGCCTGTAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
|*|||||*|||||||||||*|||
GCAGGCTTGGGACGGCCTGTAGG
Mismatch:
.C.....................
.......T...............
...................T...
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr15:88384790-88384813
Genomic Sequence:CGAGGCAAGGGAGGGCCTGAAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGAGGCAAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
*|||||*|||||*||||||||||
CGAGGCAAGGGAGGGCCTGAAGG
Mismatch:
C......................
......A................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr14:95285572-95285595
Genomic Sequence:CGAGGCAAGGGAGGGCCTGAAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGAGGCAAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
*|||||*|||||*||||||||||
CGAGGCAAGGGAGGGCCTGAAGG
Mismatch:
C......................
......A................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr7:87959859-87959882
Genomic Sequence:TCAGGCTAGGGAGGGCCTGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:TCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
T......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr13:110057111-110057134
Genomic Sequence:TCAGGCTAGGGAGGGCCTGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:TCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
T......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr6:34425968-34425991
Genomic Sequence:TCAGGCTAGGGAGGGCCTGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:TCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
T......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr4:80219007-80219030
Genomic Sequence:TCAGGCTAGGGAGGGCCTGAAGG
Strand:+
Genomic Region:gene(LINC01088)
3' PAM Orientation:TCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
TCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
T......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr3:132101803-132101826
Genomic Sequence:CCAGGCTAGGGAGGGCCTGAAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
CCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
C......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr2:24059826-24059849
Genomic Sequence:CCAGGCTAGGGAGGGCCTGAAGG
Strand:-
Genomic Region:gene(ATAD2B)
3' PAM Orientation:CCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
CCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
C......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chr4:88619036-88619059
Genomic Sequence:CCAGGCTAGGGAGGGCCTGAAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CCAGGCTAGGGAGGGCCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
**||||||||||*||||||||||
CCAGGCTAGGGAGGGCCTGAAGG
Mismatch:
C......................
.C.....................
............G..........
Distal mismatch
Distal mismatch
Proximal seed mismatch
13
Number of Mismatches:3
Location:chr10:97389027-97389050
Genomic Sequence:GGAGGCTGGGGACTGGCTGAAGG
Strand:+
Genomic Region:gene(ALDH18A1)
3' PAM Orientation:GGAGGCTGGGGACTGGCTGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
|||||||*|||||*|*|||||||
GGAGGCTGGGGACTGGCTGAAGG
Mismatch:
.......G...............
.............T.........
...............G.......
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
14
Number of Mismatches:3
Location:chr5:133417743-133417766
Genomic Sequence:GGAGGGTAGGGAGGGCATGAAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGAGGGTAGGGAGGGCATGAAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
|||||*||||||*|||*||||||
GGAGGGTAGGGAGGGCATGAAGG
Mismatch:
.....G.................
............G..........
................A......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr7:158830855-158830878
Genomic Sequence:GGAGGCAAGGGACCGCCTGTAGG
Strand:-
Genomic Region:gene(VIPR2)
3' PAM Orientation:GGAGGCAAGGGACCGCCTGTAGG
Alignment:
GGAGGCTAGGGACGGCCTGAAGG
||||||*||||||*|||||*|||
GGAGGCAAGGGACCGCCTGTAGG
Mismatch:
......A................
.............C.........
...................T...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713241741
hs0257132342761
hs0257132304377
hs0257132294680
hs0257132276397
hs0257132266498
hs02571322567101
hs02571322473107
hs02571322374108
hs02571322293127
hs02571322194128
hs02571322095129
hs02571321996130

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Csp2014IGGAGGCGGAGGCGGAGGCTAGGGACGGCCTGAAGG
RlaIVCWGCTGGAGGCTAGGGACGGCCTGAAGG
RlaIVCWCCTGGAGGCTAGGGACGGCCTGAAGG
CviJIRGCYGGCTGGAGGCTAGGGACGGCCTGAAGG
CviJIRGCYGGCCGGAGGCTAGGGACGGCCTGAAGG
FinIGGGACGGGACGGAGGCTAGGGACGGCCTGAAGG
MaeICTAGCTAGGGAGGCTAGGGACGGCCTGAAGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs18440711666437726643773+CCC/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.
× Warning! This gRNA has a low delta G which can lead to greater secondary structures.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments