grID Information

Summary

grID: hs025713243
Sequence (23-mer): GGCTAGGGACGGCCTGAAGGCGG
grID Score: high (800)
Doench (2014) Score: 0.41063
Doench (2016) Score: 0.54421
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643764-6643786
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537622
NM_014865 NCAPD2chr12660329766411322632
NM_001039670 IFFO1chr12664869366652494907
NM_001193457 IFFO1chr12664869366652494907

Browser View

Sequence Analysis

Target Sequence (RNA): GGCUAGGGACGGCCUGAAGG
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 70
GC-score: high
Tm (°C): 69.12
Tm score: moderate
RNAfold (dot bracket): ((((......))))......
deltaG (Kcal/mol): -4.30
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 0
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches:

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132411044
hs0257132343064
hs0257132304680
hs0257132294983
hs02571322766100
hs02571322667101
hs02571322570104
hs02571322476110
hs02571322377111
hs02571322296130
hs02571322197131
hs02571322098132
hs02571321999133

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Ssp6803IVGAAGGCGAAGGCGGCTAGGGACGGCCTGAAGGCGG
MaeICTAGCTAGGGCTAGGGACGGCCTGAAGGCGG
BsiYICCNNNNNNNGGCCTGAAGGCGGGGCTAGGGACGGCCTGAAGGCGG
FinIGGGACGGGACGGCTAGGGACGGCCTGAAGGCGG
RlaIVCWGCTGGCTAGGGACGGCCTGAAGGCGG
RlaIVCWCCTGGCTAGGGACGGCCTGAAGGCGG
HaeIIIGGCCGGCCGGCTAGGGACGGCCTGAAGGCGG
CviJIRGCYGGCTGGCTAGGGACGGCCTGAAGGCGG
CviJIRGCYGGCCGGCTAGGGACGGCCTGAAGGCGG
PsuGIBBCGDGGCGGGGCTAGGGACGGCCTGAAGGCGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs18440711666437726643773+CCC/Gsingleintron,near-gene-5,untranslated-5
rs57102823866437846643785+GGA/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has the potential for more than 25 offtargets in the genome.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments