grID Information

Summary

grID: hs025713246
Sequence (23-mer): GGACGGCCTGAAGGCGGCAGGGG
grID Score: moderate (500)
Doench (2014) Score: 0.36240
Doench (2016) Score: 0.35275
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643770-6643792
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537616
NM_014865 NCAPD2chr12660329766411322638
NM_001039670 IFFO1chr12664869366652494901
NM_001193457 IFFO1chr12664869366652494901

Browser View

Sequence Analysis

Target Sequence (RNA): GGACGGCCUGAAGGCGGCAG
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: none
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 75
GC-score: high
Tm (°C): 69.24
Tm score: moderate
RNAfold (dot bracket): ...(.(((....))).)...
deltaG (Kcal/mol): -5.00
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 10
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 10
1chr12:6643769-66437920
GGACGGCCTGAAGGCGGCAGGGG
|||||||||||||||||||||||
GGACGGCCTGAAGGCGGCAGGGG
2chr15:66316237-663162603
GGACGGCCTGAAGGCGGCAGGGG
||*|||*||||||||*|||||||
GGTCGGTCTGAAGGCTGCAGGGG
3chr9:137386706-1373867293
CCCCTGCCGCCTTCAGGCCGTCC
|||||||*|||*|||||||*|||
CCCCTGCGGCCATCAGGCCCTCC
4chr2:135476063-1354760863
GGACGGCCTGAAGGCGGCAGGGG
||*||||||||||||*||*||||
GGTCGGCCTGAAGGCAGCTGGGG
5chr9:137851818-1378518413
GGACGGCCTGAAGGCGGCAGGGG
|||||||*|||||||*|||||*|
GGACGGCATGAAGGCTGCAGGTG
6chr3:127292512-1272925353
CCCCTGCCGCCTTCAGGCCGTCC
|||||||*||||*||||||*|||
CCCCTGCGGCCTACAGGCCCTCC
7chr19:34745922-347459453
GGACGGCCTGAAGGCGGCAGGGG
||*|||||||**|||||||||||
GGGCGGCCTGCTGGCGGCAGGGG
8chr17:61775860-617758833
CCCCTGCCGCCTTCAGGCCGTCC
|||||||||*||*||||||*|||
CCCCTGCCGGCTACAGGCCCTCC
9chr2:70352348-703523713
GGACGGCCTGAAGGCGGCAGGGG
||||||*|||*||*|||||||||
GGACGGGCTGGAGCCGGCAGGGG
10chr17:80039271-800392943
GGACGGCCTGAAGGCGGCAGGGG
||||||||||*|*|||||||||*
GGACGGCCTGTATGCGGCAGGGC
11chr10:7231668-72316913
CCCCTGCCGCCTTCAGGCCGTCC
|||*||||*|||*||||||||||
CCCGTGCCCCCTACAGGCCGTCC
1
Number of Mismatches:0
Location:chr12:6643769-6643792
Genomic Sequence:GGACGGCCTGAAGGCGGCAGGGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:GGACGGCCTGAAGGCGGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
|||||||||||||||||||||||
GGACGGCCTGAAGGCGGCAGGGG
Mismatch:
2
Number of Mismatches:3
Location:chr15:66316237-66316260
Genomic Sequence:GGTCGGTCTGAAGGCTGCAGGGG
Strand:+
Genomic Region:gene(MEGF11)
3' PAM Orientation:GGTCGGTCTGAAGGCTGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
||*|||*||||||||*|||||||
GGTCGGTCTGAAGGCTGCAGGGG
Mismatch:
..T....................
......T................
...............T.......
Distal mismatch
Distal mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr9:137386706-137386729
Genomic Sequence:GGAGGGCCTGATGGCCGCAGGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGAGGGCCTGATGGCCGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
|||*|||||||*|||*|||||||
GGAGGGCCTGATGGCCGCAGGGG
Mismatch:
...G...................
...........T...........
...............C.......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr2:135476063-135476086
Genomic Sequence:GGTCGGCCTGAAGGCAGCTGGGG
Strand:+
Genomic Region:gene(TMEM163)
3' PAM Orientation:GGTCGGCCTGAAGGCAGCTGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
||*||||||||||||*||*||||
GGTCGGCCTGAAGGCAGCTGGGG
Mismatch:
..T....................
...............A.......
..................T....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr9:137851818-137851841
Genomic Sequence:GGACGGCATGAAGGCTGCAGGTG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGACGGCATGAAGGCTGCAGGTG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
|||||||*|||||||*|||||*|
GGACGGCATGAAGGCTGCAGGTG
Mismatch:
.......A...............
...............T.......
.....................T.
Distal seed mismatch
Proximal seed mismatch
PAM mismatch
6
Number of Mismatches:3
Location:chr3:127292512-127292535
Genomic Sequence:GGAGGGCCTGTAGGCCGCAGGGG
Strand:-
Genomic Region:CDS(NM_001136053.cds10)
3' PAM Orientation:GGAGGGCCTGTAGGCCGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
|||*||||||*||||*|||||||
GGAGGGCCTGTAGGCCGCAGGGG
Mismatch:
...G...................
..........T............
...............C.......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr19:34745922-34745945
Genomic Sequence:GGGCGGCCTGCTGGCGGCAGGGG
Strand:+
Genomic Region:gene(KIAA0355)
3' PAM Orientation:GGGCGGCCTGCTGGCGGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
||*|||||||**|||||||||||
GGGCGGCCTGCTGGCGGCAGGGG
Mismatch:
..G....................
..........C............
...........T...........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr17:61775860-61775883
Genomic Sequence:GGAGGGCCTGTAGCCGGCAGGGG
Strand:-
Genomic Region:gene(LIMD2)
3' PAM Orientation:GGAGGGCCTGTAGCCGGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
|||*||||||*||*|||||||||
GGAGGGCCTGTAGCCGGCAGGGG
Mismatch:
...G...................
..........T............
.............C.........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr2:70352348-70352371
Genomic Sequence:GGACGGGCTGGAGCCGGCAGGGG
Strand:+
Genomic Region:exon(NR_024444.exon0)
3' PAM Orientation:GGACGGGCTGGAGCCGGCAGGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
||||||*|||*||*|||||||||
GGACGGGCTGGAGCCGGCAGGGG
Mismatch:
......G................
..........G............
.............C.........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr17:80039271-80039294
Genomic Sequence:GGACGGCCTGTATGCGGCAGGGC
Strand:+
Genomic Region:gene(FASN)
3' PAM Orientation:GGACGGCCTGTATGCGGCAGGGC
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
||||||||||*|*|||||||||*
GGACGGCCTGTATGCGGCAGGGC
Mismatch:
..........T............
............T..........
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch
11
Number of Mismatches:3
Location:chr10:7231668-7231691
Genomic Sequence:GGACGGCCTGTAGGGGGCACGGG
Strand:-
Genomic Region:gene(SFMBT2)
3' PAM Orientation:GGACGGCCTGTAGGGGGCACGGG
Alignment:
GGACGGCCTGAAGGCGGCAGGGG
||||||||||*|||*||||*|||
GGACGGCCTGTAGGGGGCACGGG
Mismatch:
..........T............
..............G........
...................C...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs0257132411650
hs0257132343670
hs0257132305286
hs0257132295589
hs02571322772106
hs02571322673107
hs02571322576110
hs02571322482116
hs02571322383117

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
CviJIRGCYGGCCGGACGGCCTGAAGGCGGCAGGGG
BisIGCNGCGCGGCGGACGGCCTGAAGGCGGCAGGGG
Fnu4HIGCNGCGCGGCGGACGGCCTGAAGGCGGCAGGGG
HaeIIIGGCCGGCCGGACGGCCTGAAGGCGGCAGGGG
Ssp6803IVGAAGGCGAAGGCGGACGGCCTGAAGGCGGCAGGGG
PsuGIBBCGDGGCGGGGACGGCCTGAAGGCGGCAGGGG
TauIGCSGCGCGGCGGACGGCCTGAAGGCGGCAGGGG
RlaIVCWCCTGGACGGCCTGAAGGCGGCAGGGG
RlaIVCWGCAGGACGGCCTGAAGGCGGCAGGGG
BsiYICCNNNNNNNGGCCTGAAGGCGGGGACGGCCTGAAGGCGGCAGGGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs18440711666437726643773+CCC/Gsingleintron,near-gene-5,untranslated-5
rs57102823866437846643785+GGA/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA has a high GC content which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments