grID Information

Summary

grID: hs025713247
Sequence (23-mer): CGGCCTGAAGGCGGCAGGGGCGG
grID Score: high (700)
Doench (2014) Score: 0.03807
Doench (2016) Score: 0.22134
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643773-6643795
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537613
NM_014865 NCAPD2chr12660329766411322641
NM_001039670 IFFO1chr12664869366652494898
NM_001193457 IFFO1chr12664869366652494898

Browser View

Sequence Analysis

Target Sequence (RNA): CGGCCUGAAGGCGGCAGGGG
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 80
GC-score: high
Tm (°C): 69.91
Tm score: high
RNAfold (dot bracket): ...((((.......))))..
deltaG (Kcal/mol): -4.40
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 10
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 10
1chr12:6643772-66437950
CGGCCTGAAGGCGGCAGGGGCGG
|||||||||||||||||||||||
CGGCCTGAAGGCGGCAGGGGCGG
2chr15:73672810-736728333
CCGCCCCTGCCGCCTTCAGGCCG
||||||||*||||||||||*||*
CCGCCCCTCCCGCCTTCAGCCCC
3chr19:51844364-518443873
CCGCCCCTGCCGCCTTCAGGCCG
|*|||||||||||||*||*||||
CGGCCCCTGCCGCCTACACGCCG
4chr20:17919843-179198663
CCGCCCCTGCCGCCTTCAGGCCG
*||||||||||||||*|||||*|
GCGCCCCTGCCGCCTACAGGCGG
5chr1:201617885-2016179083
CGGCCTGAAGGCGGCAGGGGCGG
||||**|||||||||||*|||||
CGGCAGGAAGGCGGCAGCGGCGG
6chr7:139208740-1392087633
CCGCCCCTGCCGCCTTCAGGCCG
|||||||*||||||**|||||||
CCGCCCCAGCCGCCAACAGGCCG
7chr10:94050780-940508033
CGGCCTGAAGGCGGCAGGGGCGG
|||||*||*|||||||||*||||
CGGCCAGACGGCGGCAGGCGCGG
8chr8:136469950-1364699733
CCGCCCCTGCCGCCTTCAGGCCG
|||||*|*|||||||||*|||||
CCGCCGCAGCCGCCTTCTGGCCG
9chr12:8661900-86619233
CGGCCTGAAGGCGGCAGGGGCGG
|*||||||||||*|*||||||||
CAGCCTGAAGGCAGTAGGGGCGG
10chr12:2544368-25443913
CCGCCCCTGCCGCCTTCAGGCCG
||*||||||||*||||||||||*
CCCCCCCTGCCCCCTTCAGGCCC
11chr14:21559649-215596723
CCGCCCCTGCCGCCTTCAGGCCG
*||||||*|||*|||||||||||
GCGCCCCAGCCCCCTTCAGGCCG
1
Number of Mismatches:0
Location:chr12:6643772-6643795
Genomic Sequence:CGGCCTGAAGGCGGCAGGGGCGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:CGGCCTGAAGGCGGCAGGGGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|||||||||||||||||||||||
CGGCCTGAAGGCGGCAGGGGCGG
Mismatch:
2
Number of Mismatches:3
Location:chr15:73672810-73672833
Genomic Sequence:GGGGCTGAAGGCGGGAGGGGCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGGGCTGAAGGCGGGAGGGGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
*||*||||||||||*||||||||
GGGGCTGAAGGCGGGAGGGGCGG
Mismatch:
G......................
...G...................
..............G........
Distal mismatch
Distal mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr19:51844364-51844387
Genomic Sequence:CGGCGTGTAGGCGGCAGGGGCCG
Strand:-
Genomic Region:gene(VSIG10L)
3' PAM Orientation:CGGCGTGTAGGCGGCAGGGGCCG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
||||*||*|||||||||||||*|
CGGCGTGTAGGCGGCAGGGGCCG
Mismatch:
....G..................
.......T...............
.....................C.
Distal mismatch
Distal seed mismatch
PAM mismatch
4
Number of Mismatches:3
Location:chr20:17919843-17919866
Genomic Sequence:CCGCCTGTAGGCGGCAGGGGCGC
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CCGCCTGTAGGCGGCAGGGGCGC
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|*|||||*||||||||||||||*
CCGCCTGTAGGCGGCAGGGGCGC
Mismatch:
.C.....................
.......T...............
......................C
Distal mismatch
Distal seed mismatch
PAM mismatch
5
Number of Mismatches:3
Location:chr1:201617885-201617908
Genomic Sequence:CGGCAGGAAGGCGGCAGCGGCGG
Strand:+
Genomic Region:exon(NM_020443.exon0)
3' PAM Orientation:CGGCAGGAAGGCGGCAGCGGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
||||**|||||||||||*|||||
CGGCAGGAAGGCGGCAGCGGCGG
Mismatch:
....A..................
.....G.................
.................C.....
Distal mismatch
Distal mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr7:139208740-139208763
Genomic Sequence:CGGCCTGTTGGCGGCTGGGGCGG
Strand:-
Genomic Region:exon(NM_001080511.exon0)
3' PAM Orientation:CGGCCTGTTGGCGGCTGGGGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|||||||**||||||*|||||||
CGGCCTGTTGGCGGCTGGGGCGG
Mismatch:
.......T...............
........T..............
...............T.......
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr10:94050780-94050803
Genomic Sequence:CGGCCAGACGGCGGCAGGCGCGG
Strand:+
Genomic Region:exon(NM_014912.exon0)
3' PAM Orientation:CGGCCAGACGGCGGCAGGCGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|||||*||*|||||||||*||||
CGGCCAGACGGCGGCAGGCGCGG
Mismatch:
.....A.................
........C..............
..................C....
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr8:136469950-136469973
Genomic Sequence:CGGCCAGAAGGCGGCTGCGGCGG
Strand:-
Genomic Region:exon(NM_006558.exon0)
3' PAM Orientation:CGGCCAGAAGGCGGCTGCGGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|||||*|||||||||*|*|||||
CGGCCAGAAGGCGGCTGCGGCGG
Mismatch:
.....A.................
...............T.......
.................C.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr12:8661900-8661923
Genomic Sequence:CAGCCTGAAGGCAGTAGGGGCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CAGCCTGAAGGCAGTAGGGGCGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|*||||||||||*|*||||||||
CAGCCTGAAGGCAGTAGGGGCGG
Mismatch:
.A.....................
............A..........
..............T........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr12:2544368-2544391
Genomic Sequence:GGGCCTGAAGGGGGCAGGGGGGG
Strand:-
Genomic Region:gene(CACNA1C)
3' PAM Orientation:GGGCCTGAAGGGGGCAGGGGGGG
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
*||||||||||*||||||||*||
GGGCCTGAAGGGGGCAGGGGGGG
Mismatch:
G......................
...........G...........
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
11
Number of Mismatches:3
Location:chr14:21559649-21559672
Genomic Sequence:CGGCCTGAAGGGGGCTGGGGCGC
Strand:-
Genomic Region:exon(NM_001102454.exon3)
3' PAM Orientation:CGGCCTGAAGGGGGCTGGGGCGC
Alignment:
CGGCCTGAAGGCGGCAGGGGCGG
|||||||||||*|||*||||||*
CGGCCTGAAGGGGGCTGGGGCGC
Mismatch:
...........G...........
...............T.......
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713250-727
hs025713249-628
hs0257132411953
hs0257132343973
hs0257132305589
hs0257132295892
hs02571322775109
hs02571322676110
hs02571322579113
hs02571322485119
hs02571322386120

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
RlaIVCWGCACGGCCTGAAGGCGGCAGGGGCGG
PsuGIBBCGDGGCGGCGGCCTGAAGGCGGCAGGGGCGG
PsuGIBBCGDGGCGGCGGCCTGAAGGCGGCAGGGGCGG
Ssp6803IVGAAGGCGAAGGCCGGCCTGAAGGCGGCAGGGGCGG
CviJIRGCYGGCCCGGCCTGAAGGCGGCAGGGGCGG
MwoIGCNNNNNNNGCGCGGCAGGGGCCGGCCTGAAGGCGGCAGGGGCGG
Fnu4HIGCNGCGCGGCCGGCCTGAAGGCGGCAGGGGCGG
HaeIIIGGCCGGCCCGGCCTGAAGGCGGCAGGGGCGG
BsiYICCNNNNNNNGGCCTGAAGGCGGCGGCCTGAAGGCGGCAGGGGCGG
TauIGCSGCGCGGCCGGCCTGAAGGCGGCAGGGGCGG
BisIGCNGCGCGGCCGGCCTGAAGGCGGCAGGGGCGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs57102823866437846643785+GGA/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments