grID Information

Summary

grID: hs025713248
Sequence (23-mer): GGCCTGAAGGCGGCAGGGGCGGG
grID Score: moderate (600)
Doench (2014) Score: 0.00710
Doench (2016) Score: 0.25763
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643774-6643796
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537612
NM_014865 NCAPD2chr12660329766411322642
NM_001039670 IFFO1chr12664869366652494897
NM_001193457 IFFO1chr12664869366652494897

Browser View

Sequence Analysis

Target Sequence (RNA): GGCCUGAAGGCGGCAGGGGC
Target Sequence Occurrence: unique
PAM motif: GGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 80
GC-score: high
Tm (°C): 74.98
Tm score: high
RNAfold (dot bracket): ..((((.......))))...
deltaG (Kcal/mol): -4.40
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 22
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 22
1chr12:6643773-66437960
GGCCTGAAGGCGGCAGGGGCGGG
|||||||||||||||||||||||
GGCCTGAAGGCGGCAGGGGCGGG
2chr7:139208739-1392087623
CCCGCCCCTGCCGCCTTCAGGCC
||||||||*||||||**||||||
CCCGCCCCAGCCGCCAACAGGCC
3chr18:7038483-70385063
GGCCTGAAGGCGGCAGGGGCGGG
|||||||**||*|||||||||||
GGCCTGAGAGCAGCAGGGGCGGG
4chr6:33655947-336559703
GGCCTGAAGGCGGCAGGGGCGGG
||||||**|||*|||||||||||
GGCCTGTGGGCAGCAGGGGCGGG
5chr1:2986662-29866853
CCCGCCCCTGCCGCCTTCAGGCC
||||||*||||||||*||*||||
CCCGCCGCTGCCGCCATCTGGCC
6chr12:125023033-1250230563
GGCCTGAAGGCGGCAGGGGCGGG
||*|||*||||*|||||||||||
GGGCTGGAGGCAGCAGGGGCGGG
7chr16:49315788-493158113
CCCGCCCCTGCCGCCTTCAGGCC
||||||||*|||||||*|*||||
CCCGCCCCAGCCGCCTACTGGCC
8chr19:53935150-539351733
CCCGCCCCTGCCGCCTTCAGGCC
||||||||||||*|*|*||||||
CCCGCCCCTGCCCCGTACAGGCC
9chr14:103523771-1035237943
CCCGCCCCTGCCGCCTTCAGGCC
||||||||*||||||*||||*||
CCCGCCCCAGCCGCCATCAGCCC
10chr19:13107505-131075283
GGCCTGAAGGCGGCAGGGGCGGG
*|||||*||||||*|||||||||
CGCCTGGAGGCGGGAGGGGCGGG
11chr15:73672809-736728323
CCCGCCCCTGCCGCCTTCAGGCC
*||||||||*||||||||||*||
GCCGCCCCTCCCGCCTTCAGCCC
12chr20:32273712-322737353
CCCGCCCCTGCCGCCTTCAGGCC
||**||||||||||||*||||||
CCGCCCCCTGCCGCCTACAGGCC
13chr12:8661901-86619243
GGCCTGAAGGCGGCAGGGGCGGG
*||||||||||*|*|||||||||
AGCCTGAAGGCAGTAGGGGCGGG
14chr8:145448081-1454481043
GGCCTGAAGGCGGCAGGGGCGGG
||||*||||||*||*||||||||
GGCCAGAAGGCAGCGGGGGCGGG
15chr8:145202873-1452028963
GGCCTGAAGGCGGCAGGGGCGGG
||||*||||||*||*||||||||
GGCCAGAAGGCAGCGGGGGCGGG
16chr7:71626741-716267643
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|||*|||||*||||||
GGCCTGTAGGGGGCAGTGGCGGG
17chr6:168964586-1689646093
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|||*|||*||||||||
GGCCTGCAGGGGGCGGGGGCGGG
18chr7:38090986-380910093
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|||*|||||||||*||
GGCCTGCAGGTGGCAGGGGCAGG
19chr14:105959491-1059595143
GGCCTGAAGGCGGCAGGGGCGGG
|*||||||||*|||||||||*||
GTCCTGAAGGTGGCAGGGGCTGG
20chr22:37943132-379431553
GGCCTGAAGGCGGCAGGGGCGGG
|||||*||||||*||||||*|||
GGCCTAAAGGCGCCAGGGGTGGG
21chr14:104705871-1047058943
GGCCTGAAGGCGGCAGGGGCGGG
|*|||||||||*|||||||*|||
GCCCTGAAGGCTGCAGGGGTGGG
22chr2:129128105-1291281283
CCCGCCCCTGCCGCCTTCAGGCC
|||||||*|||*|||*|||||||
CCCGCCCGTGCGGCCATCAGGCC
23chr12:2544367-25443903
CCCGCCCCTGCCGCCTTCAGGCC
*||*||||||||*||||||||||
GCCCCCCCTGCCCCCTTCAGGCC
1
Number of Mismatches:0
Location:chr12:6643773-6643796
Genomic Sequence:GGCCTGAAGGCGGCAGGGGCGGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:GGCCTGAAGGCGGCAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
|||||||||||||||||||||||
GGCCTGAAGGCGGCAGGGGCGGG
Mismatch:
2
Number of Mismatches:3
Location:chr7:139208739-139208762
Genomic Sequence:GGCCTGTTGGCGGCTGGGGCGGG
Strand:-
Genomic Region:exon(NM_001080511.exon0)
3' PAM Orientation:GGCCTGTTGGCGGCTGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||**||||||*||||||||
GGCCTGTTGGCGGCTGGGGCGGG
Mismatch:
......T................
.......T...............
..............T........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr18:7038483-7038506
Genomic Sequence:GGCCTGAGAGCAGCAGGGGCGGG
Strand:+
Genomic Region:gene(LAMA1)
3' PAM Orientation:GGCCTGAGAGCAGCAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
|||||||**||*|||||||||||
GGCCTGAGAGCAGCAGGGGCGGG
Mismatch:
.......G...............
........A..............
...........A...........
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
4
Number of Mismatches:3
Location:chr6:33655947-33655970
Genomic Sequence:GGCCTGTGGGCAGCAGGGGCGGG
Strand:+
Genomic Region:gene(ITPR3)
3' PAM Orientation:GGCCTGTGGGCAGCAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||**|||*|||||||||||
GGCCTGTGGGCAGCAGGGGCGGG
Mismatch:
......T................
.......G...............
...........A...........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
5
Number of Mismatches:3
Location:chr1:2986662-2986685
Genomic Sequence:GGCCAGATGGCGGCAGCGGCGGG
Strand:-
Genomic Region:gene(PRDM16)
3' PAM Orientation:GGCCAGATGGCGGCAGCGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||*||*||||||||*||||||
GGCCAGATGGCGGCAGCGGCGGG
Mismatch:
....A..................
.......T...............
................C......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
6
Number of Mismatches:3
Location:chr12:125023033-125023056
Genomic Sequence:GGGCTGGAGGCAGCAGGGGCGGG
Strand:+
Genomic Region:gene(NCOR2)
3' PAM Orientation:GGGCTGGAGGCAGCAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||*|||*||||*|||||||||||
GGGCTGGAGGCAGCAGGGGCGGG
Mismatch:
..G....................
......G................
...........A...........
Distal mismatch
Distal mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr16:49315788-49315811
Genomic Sequence:GGCCAGTAGGCGGCTGGGGCGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGCCAGTAGGCGGCTGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||*|*|||||||*||||||||
GGCCAGTAGGCGGCTGGGGCGGG
Mismatch:
....A..................
......T................
..............T........
Distal mismatch
Distal mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr19:53935150-53935173
Genomic Sequence:GGCCTGTACGGGGCAGGGGCGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGCCTGTACGGGGCAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|*|*||||||||||||
GGCCTGTACGGGGCAGGGGCGGG
Mismatch:
......T................
........C..............
..........G............
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr14:103523771-103523794
Genomic Sequence:GGGCTGATGGCGGCTGGGGCGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGGCTGATGGCGGCTGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||*||||*||||||*||||||||
GGGCTGATGGCGGCTGGGGCGGG
Mismatch:
..G....................
.......T...............
..............T........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr19:13107505-13107528
Genomic Sequence:CGCCTGGAGGCGGGAGGGGCGGG
Strand:+
Genomic Region:gene(NFIX)
3' PAM Orientation:CGCCTGGAGGCGGGAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
*|||||*||||||*|||||||||
CGCCTGGAGGCGGGAGGGGCGGG
Mismatch:
C......................
......G................
.............G.........
Distal mismatch
Distal mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr15:73672809-73672832
Genomic Sequence:GGGCTGAAGGCGGGAGGGGCGGC
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGGCTGAAGGCGGGAGGGGCGGC
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||*||||||||||*||||||||*
GGGCTGAAGGCGGGAGGGGCGGC
Mismatch:
..G....................
.............G.........
......................C
Distal mismatch
Proximal seed mismatch
PAM mismatch
12
Number of Mismatches:3
Location:chr20:32273712-32273735
Genomic Sequence:GGCCTGTAGGCGGCAGGGGGCGG
Strand:-
Genomic Region:gene(E2F1)
3' PAM Orientation:GGCCTGTAGGCGGCAGGGGGCGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||*||||||||||||**||
GGCCTGTAGGCGGCAGGGGGCGG
Mismatch:
......T................
...................G...
....................C..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
13
Number of Mismatches:3
Location:chr12:8661901-8661924
Genomic Sequence:AGCCTGAAGGCAGTAGGGGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:AGCCTGAAGGCAGTAGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
*||||||||||*|*|||||||||
AGCCTGAAGGCAGTAGGGGCGGG
Mismatch:
A......................
...........A...........
.............T.........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
14
Number of Mismatches:3
Location:chr8:145448081-145448104
Genomic Sequence:GGCCAGAAGGCAGCGGGGGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGCCAGAAGGCAGCGGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||*||||||*||*||||||||
GGCCAGAAGGCAGCGGGGGCGGG
Mismatch:
....A..................
...........A...........
..............G........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr8:145202873-145202896
Genomic Sequence:GGCCAGAAGGCAGCGGGGGCGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGCCAGAAGGCAGCGGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||*||||||*||*||||||||
GGCCAGAAGGCAGCGGGGGCGGG
Mismatch:
....A..................
...........A...........
..............G........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
16
Number of Mismatches:3
Location:chr7:71626741-71626764
Genomic Sequence:GGCCTGTAGGGGGCAGTGGCGGG
Strand:+
Genomic Region:gene(CALN1)
3' PAM Orientation:GGCCTGTAGGGGGCAGTGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|||*|||||*||||||
GGCCTGTAGGGGGCAGTGGCGGG
Mismatch:
......T................
..........G............
................T......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
17
Number of Mismatches:3
Location:chr6:168964586-168964609
Genomic Sequence:GGCCTGCAGGGGGCGGGGGCGGG
Strand:+
Genomic Region:gene(SMOC2)
3' PAM Orientation:GGCCTGCAGGGGGCGGGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|||*|||*||||||||
GGCCTGCAGGGGGCGGGGGCGGG
Mismatch:
......C................
..........G............
..............G........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
18
Number of Mismatches:3
Location:chr7:38090986-38091009
Genomic Sequence:GGCCTGCAGGTGGCAGGGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGCCTGCAGGTGGCAGGGGCAGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||*|||*|||||||||*||
GGCCTGCAGGTGGCAGGGGCAGG
Mismatch:
......C................
..........T............
....................A..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
19
Number of Mismatches:3
Location:chr14:105959491-105959514
Genomic Sequence:GTCCTGAAGGTGGCAGGGGCTGG
Strand:+
Genomic Region:gene(C14orf80)
3' PAM Orientation:GTCCTGAAGGTGGCAGGGGCTGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
|*||||||||*|||||||||*||
GTCCTGAAGGTGGCAGGGGCTGG
Mismatch:
.T.....................
..........T............
....................T..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
20
Number of Mismatches:3
Location:chr22:37943132-37943155
Genomic Sequence:GGCCTAAAGGCGCCAGGGGTGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGCCTAAAGGCGCCAGGGGTGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
|||||*||||||*||||||*|||
GGCCTAAAGGCGCCAGGGGTGGG
Mismatch:
.....A.................
............C..........
...................T...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
21
Number of Mismatches:3
Location:chr14:104705871-104705894
Genomic Sequence:GCCCTGAAGGCTGCAGGGGTGGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GCCCTGAAGGCTGCAGGGGTGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
|*|||||||||*|||||||*|||
GCCCTGAAGGCTGCAGGGGTGGG
Mismatch:
.C.....................
...........T...........
...................T...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
22
Number of Mismatches:3
Location:chr2:129128105-129128128
Genomic Sequence:GGCCTGATGGCCGCACGGGCGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGCCTGATGGCCGCACGGGCGGG
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
|||||||*|||*|||*|||||||
GGCCTGATGGCCGCACGGGCGGG
Mismatch:
.......T...............
...........C...........
...............C.......
Distal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
23
Number of Mismatches:3
Location:chr12:2544367-2544390
Genomic Sequence:GGCCTGAAGGGGGCAGGGGGGGC
Strand:-
Genomic Region:gene(CACNA1C)
3' PAM Orientation:GGCCTGAAGGGGGCAGGGGGGGC
Alignment:
GGCCTGAAGGCGGCAGGGGCGGG
||||||||||*||||||||*||*
GGCCTGAAGGGGGCAGGGGGGGC
Mismatch:
..........G............
...................G...
......................C
Proximal seed mismatch
Proximal seed mismatch
PAM mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713250-628
hs025713249-529
hs0257132412054
hs0257132344074
hs0257132305690
hs0257132295993
hs02571322776110
hs02571322677111
hs02571322580114
hs02571322486120
hs02571322387121

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
Fnu4HIGCNGCGCGGCGGCCTGAAGGCGGCAGGGGCGGG
BsiYICCNNNNNNNGGCCTGAAGGCGGGGCCTGAAGGCGGCAGGGGCGGG
RlaIVCWCCTGGCCTGAAGGCGGCAGGGGCGGG
RlaIVCWGCAGGCCTGAAGGCGGCAGGGGCGGG
PsuGIBBCGDGGCGGGGCCTGAAGGCGGCAGGGGCGGG
PsuGIBBCGDGGCGGGGCCTGAAGGCGGCAGGGGCGGG
Ssp6803IVGAAGGCGAAGGCGGCCTGAAGGCGGCAGGGGCGGG
BisIGCNGCGCGGCGGCCTGAAGGCGGCAGGGGCGGG
HaeIIIGGCCGGCCGGCCTGAAGGCGGCAGGGGCGGG
CviJIRGCYGGCCGGCCTGAAGGCGGCAGGGGCGGG
MwoIGCNNNNNNNGCGCGGCAGGGGCGGCCTGAAGGCGGCAGGGGCGGG
TauIGCSGCGCGGCGGCCTGAAGGCGGCAGGGGCGGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs57102823866437846643785+GGA/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments