grID Information

Summary

grID: hs025713251
Sequence (23-mer): AAGGCGGCAGGGGCGGGCGCAGG
grID Score: low (100)
Doench (2014) Score: 0.03265
Doench (2016) Score: 0.31824
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643780-6643802
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537606
NM_014865 NCAPD2chr12660329766411322648
NM_001039670 IFFO1chr12664869366652494891
NM_001193457 IFFO1chr12664869366652494891

Browser View

Sequence Analysis

Target Sequence (RNA): AAGGCGGCAGGGGCGGGCGC
Target Sequence Occurrence: unique
PAM motif: AGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 85
GC-score: high
Tm (°C): 74.30
Tm score: high
RNAfold (dot bracket): ..(.(.((....)).).)..
deltaG (Kcal/mol): -4.20
Predicted Folding: moderate secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 18
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches: 1
Total Genomic Sites With 2 Mismatches:
Total Genomic Sites With 3 Mismatches: 17
1chr12:6643779-66438020
AAGGCGGCAGGGGCGGGCGCAGG
|||||||||||||||||||||||
AAGGCGGCAGGGGCGGGCGCAGG
2chr7:27147855-271478781
CCTGCGCCCGCCCCTGCCGCCTT
|||||||||||||||||||||*|
CCTGCGCCCGCCCCTGCCGCCAT
3chr14:107280968-1072809913
CCTGCGCCCGCCCCTGCCGCCTT
||||||||||||||**||||||*
CCTGCGCCCGCCCCACCCGCCTA
4chr16:33181208-331812313
AAGGCGGCAGGGGCGGGCGCAGG
**||*||||||||||||||||||
CGGGGGGCAGGGGCGGGCGCAGG
5chr16:32240244-322402673
AAGGCGGCAGGGGCGGGCGCAGG
**||*||||||||||||||||||
CGGGGGGCAGGGGCGGGCGCAGG
6chr11:69455798-694558213
CCTGCGCCCGCCCCTGCCGCCTT
||||||||||||||*|||*||*|
CCTGCGCCCGCCCCAGCCCCCAT
7chr16:32711807-327118303
CCTGCGCCCGCCCCTGCCGCCTT
||||||||||||||||||*||**
CCTGCGCCCGCCCCTGCCCCCAA
8chr14:106805134-1068051573
CCTGCGCCCGCCCCTGCCGCCTT
||||||||||||||**||||||*
CCTGCGCCCGCCCCACCCGCCTA
9chr10:43869072-438690953
CCTGCGCCCGCCCCTGCCGCCTT
|||||*||||||||||||*|||*
CCTGCCCCCGCCCCTGCCCCCTA
10chr7:916464-9164873
CCTGCGCCCGCCCCTGCCGCCTT
||*|||||||||||*|||||||*
CCAGCGCCCGCCCCAGCCGCCTA
11chrX:44865402-448654253
CCTGCGCCCGCCCCTGCCGCCTT
|||||||||*||||*||||||*|
CCTGCGCCCCCCCCAGCCGCCAT
12chr2:202898355-2028983783
CCTGCGCCCGCCCCTGCCGCCTT
||*||||||||||||*|||*|||
CCAGCGCCCGCCCCTCCCGGCTT
13chr16:4666424-46664473
AAGGCGGCAGGGGCGGGCGCAGG
*|||||||*|||||||||||*||
GAGGCGGCGGGGGCGGGCGCTGG
14chr21:46421857-464218803
CCTGCGCCCGCCCCTGCCGCCTT
|||||*||*|||||||||*||||
CCTGCCCCGGCCCCTGCCCCCTT
15chr14:45356270-453562933
CCTGCGCCCGCCCCTGCCGCCTT
||||*|||*|||||||||||||*
CCTGGGCCGGCCCCTGCCGCCTA
16chr7:2032458-20324813
AAGGCGGCAGGGGCGGGCGCAGG
*|||||||||||||*||*|||||
CAGGCGGCAGGGGCAGGGGCAGG
17chr20:55966997-559670203
CCTGCGCCCGCCCCTGCCGCCTT
||*||||||||*||||||||||*
CCAGCGCCCGCGCCTGCCGCCTA
18chr14:105959497-1059595203
AAGGCGGCAGGGGCGGGCGCAGG
||||*|||||||||*|||*||||
AAGGTGGCAGGGGCTGGCTCAGG
19chr12:3301506-33015293
AAGGCGGCAGGGGCGGGCGCAGG
|||||*||||||||*|*||||||
AAGGCTGCAGGGGCTGCCGCAGG
1
Number of Mismatches:0
Location:chr12:6643779-6643802
Genomic Sequence:AAGGCGGCAGGGGCGGGCGCAGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:AAGGCGGCAGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
|||||||||||||||||||||||
AAGGCGGCAGGGGCGGGCGCAGG
Mismatch:
2
Number of Mismatches:1
Location:chr7:27147855-27147878
Genomic Sequence:ATGGCGGCAGGGGCGGGCGCAGG
Strand:-
Genomic Region:exon(NM_153631.exon3)
3' PAM Orientation:ATGGCGGCAGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
|*|||||||||||||||||||||
ATGGCGGCAGGGGCGGGCGCAGG
Mismatch:
.T.....................
Distal mismatch
3
Number of Mismatches:3
Location:chr14:107280968-107280991
Genomic Sequence:TAGGCGGGTGGGGCGGGCGCAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:TAGGCGGGTGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*||||||**||||||||||||||
TAGGCGGGTGGGGCGGGCGCAGG
Mismatch:
T......................
.......G...............
........T..............
Distal mismatch
Distal seed mismatch
Distal seed mismatch
4
Number of Mismatches:3
Location:chr16:33181208-33181231
Genomic Sequence:CGGGGGGCAGGGGCGGGCGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGGGGGCAGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
**||*||||||||||||||||||
CGGGGGGCAGGGGCGGGCGCAGG
Mismatch:
C......................
.G.....................
....G..................
Distal mismatch
Distal mismatch
Distal mismatch
5
Number of Mismatches:3
Location:chr16:32240244-32240267
Genomic Sequence:CGGGGGGCAGGGGCGGGCGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGGGGGCAGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
**||*||||||||||||||||||
CGGGGGGCAGGGGCGGGCGCAGG
Mismatch:
C......................
.G.....................
....G..................
Distal mismatch
Distal mismatch
Distal mismatch
6
Number of Mismatches:3
Location:chr11:69455798-69455821
Genomic Sequence:ATGGGGGCTGGGGCGGGCGCAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:ATGGGGGCTGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
|*||*|||*||||||||||||||
ATGGGGGCTGGGGCGGGCGCAGG
Mismatch:
.T.....................
....G..................
........T..............
Distal mismatch
Distal mismatch
Distal seed mismatch
7
Number of Mismatches:3
Location:chr16:32711807-32711830
Genomic Sequence:TTGGGGGCAGGGGCGGGCGCAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:TTGGGGGCAGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
**||*||||||||||||||||||
TTGGGGGCAGGGGCGGGCGCAGG
Mismatch:
T......................
.T.....................
....G..................
Distal mismatch
Distal mismatch
Distal mismatch
8
Number of Mismatches:3
Location:chr14:106805134-106805157
Genomic Sequence:TAGGCGGGTGGGGCGGGCGCAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:TAGGCGGGTGGGGCGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*||||||**||||||||||||||
TAGGCGGGTGGGGCGGGCGCAGG
Mismatch:
T......................
.......G...............
........T..............
Distal mismatch
Distal seed mismatch
Distal seed mismatch
9
Number of Mismatches:3
Location:chr10:43869072-43869095
Genomic Sequence:TAGGGGGCAGGGGCGGGGGCAGG
Strand:-
Genomic Region:exon(NM_173160.exon2)
3' PAM Orientation:TAGGGGGCAGGGGCGGGGGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*|||*||||||||||||*|||||
TAGGGGGCAGGGGCGGGGGCAGG
Mismatch:
T......................
....G..................
.................G.....
Distal mismatch
Distal mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr7:916464-916487
Genomic Sequence:TAGGCGGCTGGGGCGGGCGCTGG
Strand:-
Genomic Region:gene(GET4)
3' PAM Orientation:TAGGCGGCTGGGGCGGGCGCTGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*|||||||*|||||||||||*||
TAGGCGGCTGGGGCGGGCGCTGG
Mismatch:
T......................
........T..............
....................T..
Distal mismatch
Distal seed mismatch
PAM N Offtarget
11
Number of Mismatches:3
Location:chrX:44865402-44865425
Genomic Sequence:ATGGCGGCTGGGGGGGGCGCAGG
Strand:-
Genomic Region:gene(KDM6A)
3' PAM Orientation:ATGGCGGCTGGGGGGGGCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
|*||||||*||||*|||||||||
ATGGCGGCTGGGGGGGGCGCAGG
Mismatch:
.T.....................
........T..............
.............G.........
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chr2:202898355-202898378
Genomic Sequence:AAGCCGGGAGGGGCGGGCGCTGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:AAGCCGGGAGGGGCGGGCGCTGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
|||*|||*||||||||||||*||
AAGCCGGGAGGGGCGGGCGCTGG
Mismatch:
...C...................
.......G...............
....................T..
Distal mismatch
Distal seed mismatch
PAM N Offtarget
13
Number of Mismatches:3
Location:chr16:4666424-4666447
Genomic Sequence:GAGGCGGCGGGGGCGGGCGCTGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GAGGCGGCGGGGGCGGGCGCTGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*|||||||*|||||||||||*||
GAGGCGGCGGGGGCGGGCGCTGG
Mismatch:
G......................
........G..............
....................T..
Distal mismatch
Distal seed mismatch
PAM N Offtarget
14
Number of Mismatches:3
Location:chr21:46421857-46421880
Genomic Sequence:AAGGGGGCAGGGGCCGGGGCAGG
Strand:-
Genomic Region:gene(LINC00162)
3' PAM Orientation:AAGGGGGCAGGGGCCGGGGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
||||*|||||||||*||*|||||
AAGGGGGCAGGGGCCGGGGCAGG
Mismatch:
....G..................
..............C........
.................G.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr14:45356270-45356293
Genomic Sequence:TAGGCGGCAGGGGCCGGCCCAGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:TAGGCGGCAGGGGCCGGCCCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*|||||||||||||*|||*||||
TAGGCGGCAGGGGCCGGCCCAGG
Mismatch:
T......................
..............C........
..................C....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
16
Number of Mismatches:3
Location:chr7:2032458-2032481
Genomic Sequence:CAGGCGGCAGGGGCAGGGGCAGG
Strand:+
Genomic Region:gene(MAD1L1)
3' PAM Orientation:CAGGCGGCAGGGGCAGGGGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*|||||||||||||*||*|||||
CAGGCGGCAGGGGCAGGGGCAGG
Mismatch:
C......................
..............A........
.................G.....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
17
Number of Mismatches:3
Location:chr20:55966997-55967020
Genomic Sequence:TAGGCGGCAGGCGCGGGCGCTGG
Strand:-
Genomic Region:gene(MIR5095)
3' PAM Orientation:TAGGCGGCAGGCGCGGGCGCTGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
*||||||||||*||||||||*||
TAGGCGGCAGGCGCGGGCGCTGG
Mismatch:
T......................
...........C...........
....................T..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
18
Number of Mismatches:3
Location:chr14:105959497-105959520
Genomic Sequence:AAGGTGGCAGGGGCTGGCTCAGG
Strand:+
Genomic Region:gene(C14orf80)
3' PAM Orientation:AAGGTGGCAGGGGCTGGCTCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
||||*|||||||||*|||*||||
AAGGTGGCAGGGGCTGGCTCAGG
Mismatch:
....T..................
..............T........
..................T....
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
19
Number of Mismatches:3
Location:chr12:3301506-3301529
Genomic Sequence:AAGGCTGCAGGGGCTGCCGCAGG
Strand:+
Genomic Region:gene(TSPAN9)
3' PAM Orientation:AAGGCTGCAGGGGCTGCCGCAGG
Alignment:
AAGGCGGCAGGGGCGGGCGCAGG
|||||*||||||||*|*||||||
AAGGCTGCAGGGGCTGCCGCAGG
Mismatch:
.....T.................
..............T........
................C......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713250034
hs025713249135
hs0257132412660
hs0257132344680
hs0257132306296
hs0257132296599
hs02571322782116
hs02571322683117
hs02571322586120
hs02571322492126
hs02571322393127

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
TauIGCSGCGCGGCAAGGCGGCAGGGGCGGGCGCAGG
HhaIGCGCGCGCAAGGCGGCAGGGGCGGGCGCAGG
GlaIGCGCGCGCAAGGCGGCAGGGGCGGGCGCAGG
Cac8IGCNNGCGCGGGCAAGGCGGCAGGGGCGGGCGCAGG
Cgl13032IGGCGCAGGCGCAAAGGCGGCAGGGGCGGGCGCAGG
Fnu4HIGCNGCGCGGCAAGGCGGCAGGGGCGGGCGCAGG
Cdi11397IGCGCAGGCGCAGAAGGCGGCAGGGGCGGGCGCAGG
BisIGCNGCGCGGCAAGGCGGCAGGGGCGGGCGCAGG
MwoIGCNNNNNNNGCGCGGCAGGGGCAAGGCGGCAGGGGCGGGCGCAGG
RlaIVCWGCAAAGGCGGCAGGGGCGGGCGCAGG
RlaIVCWGCAAAGGCGGCAGGGGCGGGCGCAGG
PsuGIBBCGDGGCGGAAGGCGGCAGGGGCGGGCGCAGG
PsuGIBBCGDGGCGGAAGGCGGCAGGGGCGGGCGCAGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs57102823866437846643785+GGA/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments