grID Information

Summary

grID: hs025713252
Sequence (23-mer): CGGCAGGGGCGGGCGCAGGCCGG
grID Score: moderate (600)
Doench (2014) Score: 0.03618
Doench (2016) Score: 0.35980
Cas9: S. pyogenes

Genomic Context

Genomic Location: chr12:6643784-6643806
Strand: +
gRNA location: gene:refGene(GAPDH)

Nearest Genes

refseqgenechromstartenddistance
NM_002046 GAPDHchr12664358466475370
NM_001256799 GAPDHchr1266444086647537602
NM_014865 NCAPD2chr12660329766411322652
NM_001039670 IFFO1chr12664869366652494887
NM_001193457 IFFO1chr12664869366652494887

Browser View

Sequence Analysis

Target Sequence (RNA): CGGCAGGGGCGGGCGCAGGC
Target Sequence Occurrence: unique
PAM motif: CGG
Homopolymeric Runs: yes
Pol III Terminator: none

Thermodynamic Properties

GC-content (%): 90
GC-score: very high
Tm (°C): 73.70
Tm score: high
RNAfold (dot bracket): (.((....)).)((....))
deltaG (Kcal/mol): -2.70
Predicted Folding: low secondary structure

Offtarget Analysis

Total Predicted Genomic Targets: 33
Total Genomic Sites With 0 Mismatches:
Total Genomic Sites With 1 Mismatches:
Total Genomic Sites With 2 Mismatches: 1
Total Genomic Sites With 3 Mismatches: 32
1chr12:6643783-66438060
CGGCAGGGGCGGGCGCAGGCCGG
|||||||||||||||||||||||
CGGCAGGGGCGGGCGCAGGCCGG
2chr17:16256797-162568202
CCGGCCTGCGCCCGCCCCTGCCG
|||||||||||*||||||*||||
CCGGCCTGCGCGCGCCCCAGCCG
3chr1:1243110-12431333
CCGGCCTGCGCCCGCCCCTGCCG
|||||||||||||*||||*||*|
CCGGCCTGCGCCCCCCCCAGCGG
4chr2:96348424-963484473
CCGGCCTGCGCCCGCCCCTGCCG
|||||||||||||**|||*||||
CCGGCCTGCGCCCCGCCCAGCCG
5chr2:173941035-1739410583
CGGCAGGGGCGGGCGCAGGCCGG
|*|*|||*|||||||||||||||
CTGGAGGCGCGGGCGCAGGCCGG
6chr19:57351703-573517263
CCGGCCTGCGCCCGCCCCTGCCG
||||*||||||||*||||||||*
CCGGGCTGCGCCCCCCCCTGCCC
7chr4:25865282-258653053
CCGGCCTGCGCCCGCCCCTGCCG
||||*||||||||**||||||||
CCGGGCTGCGCCCCGCCCTGCCG
8chr4:15682942-156829653
CGGCAGGGGCGGGCGCAGGCCGG
*|||*|||||||||||*||||||
GGGCTGGGGCGGGCGCGGGCCGG
9chr4:21950416-219504393
CGGCAGGGGCGGGCGCAGGCCGG
|*|||||*|||||||*|||||||
CTGCAGGTGCGGGCGGAGGCCGG
10chr11:65631064-656310873
CGGCAGGGGCGGGCGCAGGCCGG
|**|||||||||||*||||||||
CTCCAGGGGCGGGCACAGGCCGG
11chr13:95953573-959535963
CGGCAGGGGCGGGCGCAGGCCGG
|||**|||||||||||*||||||
CGGGCGGGGCGGGCGCGGGCCGG
12chr12:52243081-522431043
CCGGCCTGCGCCCGCCCCTGCCG
||||||||*|||||||||**|||
CCGGCCTGGGCCCGCCCCACCCG
13chr15:40401012-404010353
CGGCAGGGGCGGGCGCAGGCCGG
||||*|*|||||||*||||||||
CGGCGGCGGCGGGCACAGGCCGG
14chr4:78980268-789802913
CGGCAGGGGCGGGCGCAGGCCGG
||||*|*||||||||||||*|||
CGGCGGCGGCGGGCGCAGGGCGG
15chr10:119000517-1190005403
CGGCAGGGGCGGGCGCAGGCCGG
||||**|||||||||*|||||||
CGGCGCGGGCGGGCGGAGGCCGG
16chr8:21956569-219565923
CGGCAGGGGCGGGCGCAGGCCGG
**|||||||||||||*|||||||
GAGCAGGGGCGGGCGGAGGCCGG
17chr11:45202305-452023283
CCGGCCTGCGCCCGCCCCTGCCG
||*|||*|||||||||||*||||
CCCGCCAGCGCCCGCCCCAGCCG
18chr20:61638147-616381703
CCGGCCTGCGCCCGCCCCTGCCG
||||||*|*|||||||*||||||
CCGGCCAGGGCCCGCCGCTGCCG
19chr22:51051302-510513253
CCGGCCTGCGCCCGCCCCTGCCG
||||||||**||||||||||||*
CCGGCCTGGCCCCGCCCCTGCCC
20chr2:27718003-277180263
CCGGCCTGCGCCCGCCCCTGCCG
*||||||*|||||||||||||*|
GCGGCCTCCGCCCGCCCCTGCGG
21chr13:110436990-1104370133
CGGCAGGGGCGGGCGCAGGCCGG
||||||*||||||*||*||||||
CGGCAGAGGCGGGTGCGGGCCGG
22chr1:32757835-327578583
CGGCAGGGGCGGGCGCAGGCCGG
||||*||||||||**||||||||
CGGCGGGGGCGGGGCCAGGCCGG
23chr17:79373726-793737493
CGGCAGGGGCGGGCGCAGGCCGG
||||*|||||||||||*||*|||
CGGCCGGGGCGGGCGCGGGACGG
24chr20:55966993-559670163
CCGGCCTGCGCCCGCCCCTGCCG
||*|||*||||||||*|||||||
CCCGCCAGCGCCCGCGCCTGCCG
25chr19:18392371-183923943
CCGGCCTGCGCCCGCCCCTGCCG
|*|*||||||||||||||*||||
CGGCCCTGCGCCCGCCCCAGCCG
26chr6:168758353-1687583763
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
27chr7:27147851-271478743
CCGGCCTGCGCCCGCCCCTGCCG
*|**|||||||||||||||||||
GCCCCCTGCGCCCGCCCCTGCCG
28chr6:168758903-1687589263
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
29chr14:45356266-453562893
CCGGCCTGCGCCCGCCCCTGCCG
|||*||||*|||*||||||||||
CCGCCCTGGGCCGGCCCCTGCCG
30chr6:168759562-1687595853
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
31chr6:168758299-1687583223
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
32chr8:37352868-373528913
CCGGCCTGCGCCCGCCCCTGCCG
||*|||*|||||*||||||||||
CCCGCCAGCGCCGGCCCCTGCCG
33chr6:168759616-1687596393
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
34chr6:168758957-1687589803
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
1
Number of Mismatches:0
Location:chr12:6643783-6643806
Genomic Sequence:CGGCAGGGGCGGGCGCAGGCCGG
Strand:+
Genomic Region:gene(GAPDH)
3' PAM Orientation:CGGCAGGGGCGGGCGCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|||||||||||||||||||||||
CGGCAGGGGCGGGCGCAGGCCGG
Mismatch:
2
Number of Mismatches:2
Location:chr17:16256797-16256820
Genomic Sequence:CGGCTGGGGCGCGCGCAGGCCGG
Strand:-
Genomic Region:exon(NM_181716.exon0)
3' PAM Orientation:CGGCTGGGGCGCGCGCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*||||||*|||||||||||
CGGCTGGGGCGCGCGCAGGCCGG
Mismatch:
....T..................
...........C...........
Distal mismatch
Proximal seed mismatch
3
Number of Mismatches:3
Location:chr1:1243110-1243133
Genomic Sequence:CCGCTGGGGGGGGCGCAGGCCGG
Strand:-
Genomic Region:gene(ACAP3)
3' PAM Orientation:CCGCTGGGGGGGGCGCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|*||*||||*|||||||||||||
CCGCTGGGGGGGGCGCAGGCCGG
Mismatch:
.C.....................
....T..................
.........G.............
Distal mismatch
Distal mismatch
Distal seed mismatch
4
Number of Mismatches:3
Location:chr2:96348424-96348447
Genomic Sequence:CGGCTGGGCGGGGCGCAGGCCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGGCTGGGCGGGGCGCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*|||**|||||||||||||
CGGCTGGGCGGGGCGCAGGCCGG
Mismatch:
....T..................
........C..............
.........G.............
Distal mismatch
Distal seed mismatch
Distal seed mismatch
5
Number of Mismatches:3
Location:chr2:173941035-173941058
Genomic Sequence:CTGGAGGCGCGGGCGCAGGCCGG
Strand:+
Genomic Region:gene(ZAK)
3' PAM Orientation:CTGGAGGCGCGGGCGCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|*|*|||*|||||||||||||||
CTGGAGGCGCGGGCGCAGGCCGG
Mismatch:
.T.....................
...G...................
.......C...............
Distal mismatch
Distal mismatch
Distal seed mismatch
6
Number of Mismatches:3
Location:chr19:57351703-57351726
Genomic Sequence:GGGCAGGGGGGGGCGCAGCCCGG
Strand:-
Genomic Region:gene(PEG3)
3' PAM Orientation:GGGCAGGGGGGGGCGCAGCCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
*||||||||*||||||||*||||
GGGCAGGGGGGGGCGCAGCCCGG
Mismatch:
G......................
.........G.............
..................C....
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
7
Number of Mismatches:3
Location:chr4:25865282-25865305
Genomic Sequence:CGGCAGGGCGGGGCGCAGCCCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGCGGGGCGCAGCCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||**||||||||*||||
CGGCAGGGCGGGGCGCAGCCCGG
Mismatch:
........C..............
.........G.............
..................C....
Distal seed mismatch
Distal seed mismatch
Proximal seed mismatch
8
Number of Mismatches:3
Location:chr4:15682942-15682965
Genomic Sequence:GGGCTGGGGCGGGCGCGGGCCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:GGGCTGGGGCGGGCGCGGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
*|||*|||||||||||*||||||
GGGCTGGGGCGGGCGCGGGCCGG
Mismatch:
G......................
....T..................
................G......
Distal mismatch
Distal mismatch
Proximal seed mismatch
9
Number of Mismatches:3
Location:chr4:21950416-21950439
Genomic Sequence:CTGCAGGTGCGGGCGGAGGCCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CTGCAGGTGCGGGCGGAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|*|||||*|||||||*|||||||
CTGCAGGTGCGGGCGGAGGCCGG
Mismatch:
.T.....................
.......T...............
...............G.......
Distal mismatch
Distal seed mismatch
Proximal seed mismatch
10
Number of Mismatches:3
Location:chr11:65631064-65631087
Genomic Sequence:CTCCAGGGGCGGGCACAGGCCGG
Strand:+
Genomic Region:exon(NM_025128.exon8)
3' PAM Orientation:CTCCAGGGGCGGGCACAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|**|||||||||||*||||||||
CTCCAGGGGCGGGCACAGGCCGG
Mismatch:
.T.....................
..C....................
..............A........
Distal mismatch
Distal mismatch
Proximal seed mismatch
11
Number of Mismatches:3
Location:chr13:95953573-95953596
Genomic Sequence:CGGGCGGGGCGGGCGCGGGCCGG
Strand:+
Genomic Region:exon(NM_005845.exon0)
3' PAM Orientation:CGGGCGGGGCGGGCGCGGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|||**|||||||||||*||||||
CGGGCGGGGCGGGCGCGGGCCGG
Mismatch:
...G...................
....C..................
................G......
Distal mismatch
Distal mismatch
Proximal seed mismatch
12
Number of Mismatches:3
Location:chr12:52243081-52243104
Genomic Sequence:CGGGTGGGGCGGGCCCAGGCCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGGGTGGGGCGGGCCCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|||**|||||||||*||||||||
CGGGTGGGGCGGGCCCAGGCCGG
Mismatch:
...G...................
....T..................
..............C........
Distal mismatch
Distal mismatch
Proximal seed mismatch
13
Number of Mismatches:3
Location:chr15:40401012-40401035
Genomic Sequence:CGGCGGCGGCGGGCACAGGCCGG
Strand:+
Genomic Region:exon(NM_001003943.exon0)
3' PAM Orientation:CGGCGGCGGCGGGCACAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*|*|||||||*||||||||
CGGCGGCGGCGGGCACAGGCCGG
Mismatch:
....G..................
......C................
..............A........
Distal mismatch
Distal mismatch
Proximal seed mismatch
14
Number of Mismatches:3
Location:chr4:78980268-78980291
Genomic Sequence:CGGCGGCGGCGGGCGCAGGGCGG
Strand:+
Genomic Region:gene(FRAS1)
3' PAM Orientation:CGGCGGCGGCGGGCGCAGGGCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*|*||||||||||||*|||
CGGCGGCGGCGGGCGCAGGGCGG
Mismatch:
....G..................
......C................
...................G...
Distal mismatch
Distal mismatch
Proximal seed mismatch
15
Number of Mismatches:3
Location:chr10:119000517-119000540
Genomic Sequence:CGGCGCGGGCGGGCGGAGGCCGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCGCGGGCGGGCGGAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||**|||||||||*|||||||
CGGCGCGGGCGGGCGGAGGCCGG
Mismatch:
....G..................
.....C.................
...............G.......
Distal mismatch
Distal mismatch
Proximal seed mismatch
16
Number of Mismatches:3
Location:chr8:21956569-21956592
Genomic Sequence:GAGCAGGGGCGGGCGGAGGCCGG
Strand:+
Genomic Region:gene(FAM160B2)
3' PAM Orientation:GAGCAGGGGCGGGCGGAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
**|||||||||||||*|||||||
GAGCAGGGGCGGGCGGAGGCCGG
Mismatch:
G......................
.A.....................
...............G.......
Distal mismatch
Distal mismatch
Proximal seed mismatch
17
Number of Mismatches:3
Location:chr11:45202305-45202328
Genomic Sequence:CGGCTGGGGCGGGCGCTGGCGGG
Strand:-
Genomic Region:gene(PRDM11)
3' PAM Orientation:CGGCTGGGGCGGGCGCTGGCGGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*|||||||||||*|||*||
CGGCTGGGGCGGGCGCTGGCGGG
Mismatch:
....T..................
................T......
....................G..
Distal mismatch
Proximal seed mismatch
PAM N Offtarget
18
Number of Mismatches:3
Location:chr20:61638147-61638170
Genomic Sequence:CGGCAGCGGCGGGCCCTGGCCGG
Strand:-
Genomic Region:five(NM_080606.utr0a)
3' PAM Orientation:CGGCAGCGGCGGGCCCTGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||*|||||||*|*||||||
CGGCAGCGGCGGGCCCTGGCCGG
Mismatch:
......C................
..............C........
................T......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
19
Number of Mismatches:3
Location:chr22:51051302-51051325
Genomic Sequence:GGGCAGGGGCGGGGCCAGGCCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:GGGCAGGGGCGGGGCCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
*||||||||||||**||||||||
GGGCAGGGGCGGGGCCAGGCCGG
Mismatch:
G......................
.............G.........
..............C........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
20
Number of Mismatches:3
Location:chr2:27718003-27718026
Genomic Sequence:CCGCAGGGGCGGGCGGAGGCCGC
Strand:-
Genomic Region:gene(FNDC4)
3' PAM Orientation:CCGCAGGGGCGGGCGGAGGCCGC
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|*|||||||||||||*||||||*
CCGCAGGGGCGGGCGGAGGCCGC
Mismatch:
.C.....................
...............G.......
......................C
Distal mismatch
Proximal seed mismatch
PAM mismatch
21
Number of Mismatches:3
Location:chr13:110436990-110437013
Genomic Sequence:CGGCAGAGGCGGGTGCGGGCCGG
Strand:+
Genomic Region:exon(NM_003749.exon0)
3' PAM Orientation:CGGCAGAGGCGGGTGCGGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||*||||||*||*||||||
CGGCAGAGGCGGGTGCGGGCCGG
Mismatch:
......A................
.............T.........
................G......
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
22
Number of Mismatches:3
Location:chr1:32757835-32757858
Genomic Sequence:CGGCGGGGGCGGGGCCAGGCCGG
Strand:+
Genomic Region:gene(HDAC1)
3' PAM Orientation:CGGCGGGGGCGGGGCCAGGCCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*||||||||**||||||||
CGGCGGGGGCGGGGCCAGGCCGG
Mismatch:
....G..................
.............G.........
..............C........
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
23
Number of Mismatches:3
Location:chr17:79373726-79373749
Genomic Sequence:CGGCCGGGGCGGGCGCGGGACGG
Strand:+
Genomic Region:gene(BAHCC1)
3' PAM Orientation:CGGCCGGGGCGGGCGCGGGACGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*|||||||||||*||*|||
CGGCCGGGGCGGGCGCGGGACGG
Mismatch:
....C..................
................G......
...................A...
Distal mismatch
Proximal seed mismatch
Proximal seed mismatch
24
Number of Mismatches:3
Location:chr20:55966993-55967016
Genomic Sequence:CGGCAGGCGCGGGCGCTGGCGGG
Strand:-
Genomic Region:gene(MIR5095)
3' PAM Orientation:CGGCAGGCGCGGGCGCTGGCGGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|||||||*||||||||*|||*||
CGGCAGGCGCGGGCGCTGGCGGG
Mismatch:
.......C...............
................T......
....................G..
Distal seed mismatch
Proximal seed mismatch
PAM N Offtarget
25
Number of Mismatches:3
Location:chr19:18392371-18392394
Genomic Sequence:CGGCTGGGGCGGGCGCAGGGCCG
Strand:-
Genomic Region:five(NM_005354.utr0a)
3' PAM Orientation:CGGCTGGGGCGGGCGCAGGGCCG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||*||||||||||||||*|*|
CGGCTGGGGCGGGCGCAGGGCCG
Mismatch:
....T..................
...................G...
.....................C.
Distal mismatch
Proximal seed mismatch
PAM mismatch
26
Number of Mismatches:3
Location:chr6:168758353-168758376
Genomic Sequence:CGGCAGGGGCGGCCCCAGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCGGCCCCAGGCAGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
Mismatch:
............C..........
..............C........
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
27
Number of Mismatches:3
Location:chr7:27147851-27147874
Genomic Sequence:CGGCAGGGGCGGGCGCAGGGGGC
Strand:-
Genomic Region:exon(NM_153631.exon3)
3' PAM Orientation:CGGCAGGGGCGGGCGCAGGGGGC
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
|||||||||||||||||||**|*
CGGCAGGGGCGGGCGCAGGGGGC
Mismatch:
...................G...
....................G..
......................C
Proximal seed mismatch
PAM N Offtarget
PAM mismatch
28
Number of Mismatches:3
Location:chr6:168758903-168758926
Genomic Sequence:CGGCAGGGGCGGCCCCAGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCGGCCCCAGGCAGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
Mismatch:
............C..........
..............C........
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
29
Number of Mismatches:3
Location:chr14:45356266-45356289
Genomic Sequence:CGGCAGGGGCCGGCCCAGGGCGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCCGGCCCAGGGCGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||*|||*||||*|||
CGGCAGGGGCCGGCCCAGGGCGG
Mismatch:
..........C............
..............C........
...................G...
Proximal seed mismatch
Proximal seed mismatch
Proximal seed mismatch
30
Number of Mismatches:3
Location:chr6:168759562-168759585
Genomic Sequence:CGGCAGGGGCGGCCCCAGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCGGCCCCAGGCAGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
Mismatch:
............C..........
..............C........
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
31
Number of Mismatches:3
Location:chr6:168758299-168758322
Genomic Sequence:CGGCAGGGGCGGCCCCAGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCGGCCCCAGGCAGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
Mismatch:
............C..........
..............C........
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
32
Number of Mismatches:3
Location:chr8:37352868-37352891
Genomic Sequence:CGGCAGGGGCCGGCGCTGGCGGG
Strand:-
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCCGGCGCTGGCGGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||*|||||*|||*||
CGGCAGGGGCCGGCGCTGGCGGG
Mismatch:
..........C............
................T......
....................G..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
33
Number of Mismatches:3
Location:chr6:168759616-168759639
Genomic Sequence:CGGCAGGGGCGGCCCCAGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCGGCCCCAGGCAGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
Mismatch:
............C..........
..............C........
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget
34
Number of Mismatches:3
Location:chr6:168758957-168758980
Genomic Sequence:CGGCAGGGGCGGCCCCAGGCAGG
Strand:+
Genomic Region:intergenic
3' PAM Orientation:CGGCAGGGGCGGCCCCAGGCAGG
Alignment:
CGGCAGGGGCGGGCGCAGGCCGG
||||||||||||*|*|||||*||
CGGCAGGGGCGGCCCCAGGCAGG
Mismatch:
............C..........
..............C........
....................A..
Proximal seed mismatch
Proximal seed mismatch
PAM N Offtarget

Paired Nickase

Cas9(D10A)
PairOffsetOverhang
hs025713250438
hs025713249539
hs0257132413064
hs0257132345084
hs02571323066100
hs02571322969103
hs02571322786120
hs02571322687121
hs02571322590124
hs02571322496130
hs02571322397131

Sequence

Surrounding genomic sequence (500bp upstream and downstream target site)

Note: Repeats and low complexity DNA is shown in lower case; non repeating sequence is shown in upper case.

Screening Analysis

Restriction EnzymeRecognition SiteMatchSequence
GlaIGCGCGCGCCGGCAGGGGCGGGCGCAGGCCGG
PsuGIBBCGDGGCGGCGGCAGGGGCGGGCGCAGGCCGG
PsuGIBBCGDGCCGGCGGCAGGGGCGGGCGCAGGCCGG
CviJIRGCYGGCCCGGCAGGGGCGGGCGCAGGCCGG
HpaIICCGGCCGGCGGCAGGGGCGGGCGCAGGCCGG
HhaIGCGCGCGCCGGCAGGGGCGGGCGCAGGCCGG
Cac8IGCNNGCGCGGGCCGGCAGGGGCGGGCGCAGGCCGG
Cac8IGCNNGCGCAGGCCGGCAGGGGCGGGCGCAGGCCGG
Cdi11397IGCGCAGGCGCAGCGGCAGGGGCGGGCGCAGGCCGG
Cgl13032IGGCGCAGGCGCACGGCAGGGGCGGGCGCAGGCCGG
RlaIVCWGCACGGCAGGGGCGGGCGCAGGCCGG
RlaIVCWGCACGGCAGGGGCGGGCGCAGGCCGG
HaeIIIGGCCGGCCCGGCAGGGGCGGGCGCAGGCCGG

SNPs and Variation

NamestartendstrandrefNCBIrefUCSCobservedclassfunction
rs57102823866437846643785+GGA/Gsingleintron,near-gene-5,untranslated-5

Notes

× Warning! This gRNA contains polymeric runs which can lead to greater off-targets.
× Warning! This gRNA has a high GC content which can lead to greater off-targets.
× Warning! This gRNA has a high Tm which can lead to greater off-targets.

References

Jaskula-Ranga, V and Zack, DJ. 2016. grID: A CRISPR-Cas9 guide RNA Database and Resource for Gene-Editing.

bioRxiv 097352; doi: https://doi.org/10.1101/097352

Comments