gRNA Cloning

H1 promoter vector cloning (pH1v1) detailed

H1 Protocol Overview

Identify 23bp CRISPR Targeting sequence in the form N20NGG:


 5’- NNNNNNNNNNNNNNNNNNNN NGG -3’
 ____________________ ___
      targetsite      PAM

*Note the PAM sequence is not incorporated into the gRNA



Design oligos to insert 20bp target sequence into H1 promoter vector via Gibson Assembly:


  5’- NNNNNNNNNNNNNNNNNNNN -3’ 
 ||||||||||||||||||||
 3’- nnnnnnnnnnnnnnnnnnnn -5’

*N corresponds to N20 target site (of N20NGG);

*n corresponds to complement sequence


Forward oligo; CTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNG

Reverse oligo; CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACnnnnnnnnnnnnnnnnnnnnG



PCR reaction to anneal and extend the two oligos as below:


CTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNG
                               ||||||||||||||||||||||
                               GnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTTATTCC


CTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GAATATTCAAGACATACTCTGGTGAAAAAGGGnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTTATTCC
-------------------------------                     ----------------------------------
	   overlap						  overlap


Protocol: oligo annealing and extension

 

     F_oligo(100µM)     	0.5µl
     R_oligo(100µM)     	0.5µl
     H2O                   	11.5µl
     2X Phusion Flash      	12.5µl

ThermoCycler:

     98C      	1:00
     60C         :02
     72C         :05
          98C         :03     |
          68C         :01     | X 10 cycles
          72C         :03     |
     72C      1:00

purify reaction (Zymo DNA Clean & Concentrator-5)

quantitate DNA


Digest pH1v1 with AvrII


				       Avr II
				       ------
  TGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCCCTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC 
  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
  ACCCTTAGAATATTCAAGACATACTCTGGTGAAAAAGGGATCCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGG

TGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCC   CTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC
||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||
ACCCTTAGAATATTCAAGACATACTCTGGTGAAAAAGGGATC   CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGG


Protocol: Vector Digestion

Digest H1 gRNA Vector with Avr II (5'-CCTAGG-3') (Avr II)

     Vector ~(500ng-1µg)	x.xµl
     10X Buffer            	5.0µl
     H2O          		to 47.0µl
     AvrII           		3.0µl

 

digest at 37C to completion (preferably overnight)

purify reaction (Zymo DNA Clean & Concentrator-5)

 

Gibson Assembly


5'->3 vector resection:

TTGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCC                                    CTAGTCCGTTA
||||||||                                                                   |||||||||||
AACCCTTA                                 CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAAT


5'->3' oligo resection:

                               CNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG
			       ||||||||||||||||||||||
GAATATTCAAGACATACTCTGGTGAAAAAGGGnnnnnnnnnnnnnnnnnnnnC


annealing, extension, and ligation:

	    H1 promoter						 gRNA Scaffold
-------------------------------------                    ---------------------------->
GGAATCTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CCTTAGAATATTCAAGACATACTCTGGTGAAAAAGGGnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTT
                                     --------------------
                                            target


Protocol:Gibson Assembly

     Vector (50ng/µl)        0.5µl
     Insert (10ng/µl)        0.5µl
     2X Master Mix           1.0µl

 

50C for 15min

ice reaction immediately after 15 minutes and dilute with H2O 1:4 (add 8µl)

transform 25µl competent cells with 2µl of diluted Gibson Reaction

15 min ice

30 sec at 42C

ice 5 min

add 125µl SOC

37C for 1 hr

plate on Carbenicillin

37C o/n

 

Sequencing

Sequence verify with M13R

Final sequence (+ strand)

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAG
GCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGT
GGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAAT
GTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNN
NNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC
TTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT


Final sequence (- strand)

AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAAC
TTGCTATTTCTAGCTCTAAAACnnnnnnnnnnnnnnnnnnnnGGGAAAAAGTGGTCTCAT
ACAGAACTTATAAGATTCCCAAATCCAAAGACATTTCACGTTTATGGTGATTTCCCAGAA
CACATAGCGACATGCAAATATTGCAGGGCGCCACTCCCCTGTCCCTCACAGCCATCTTCC
TGCCAGGGCGCACGCGCGCTGGGTGTTCCCGCCTAGTGACACTGGGCCCGCGATTCCTTG
GAGCGGGTTGATGACGTCAGCGTTCGAATTCC