gRNA Cloning

H1 promoter vector cloning (pH1v1)

H1 Detailed Protocol

Identify 23bp CRISPR Targeting sequence in the form N20NGG:


 5’- NNNNNNNNNNNNNNNNNNNN NGG -3’
 ____________________ ___
      targetsite      PAM

*Note the PAM sequence is not incorporated into the gRNA



Design oligos to insert 20bp target sequence into H1 promoter vector via Gibson Assembly:


  5’- NNNNNNNNNNNNNNNNNNNN -3’ 
 ||||||||||||||||||||
 3’- nnnnnnnnnnnnnnnnnnnn -5’

*N corresponds to N20 target site (of N20NGG);

*n corresponds to complement sequence


Forward oligo; CTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNG

Reverse oligo; CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACnnnnnnnnnnnnnnnnnnnnG



PCR reaction to anneal and extend the two oligos as below:


CTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNG
                               ||||||||||||||||||||||
                               GnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTTATTCC


CTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GAATATTCAAGACATACTCTGGTGAAAAAGGGnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTTATTCC
-------------------------------                     ----------------------------------
	   overlap						  overlap


Digest pH1v1 with AvrII


				       Avr II
				       ------
  TGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCCCTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC 
  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
  ACCCTTAGAATATTCAAGACATACTCTGGTGAAAAAGGGATCCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGG


TGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCC   CTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC
||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||
ACCCTTAGAATATTCAAGACATACTCTGGTGAAAAAGGGATC   CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGG


Gibson Assembly


5'->3 vector resection:

TTGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCC                                    CTAGTCCGTTA
||||||||                                                                   |||||||||||
AACCCTTA                                 CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAAT


5'->3' oligo resection:

                               CNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG
			       ||||||||||||||||||||||
GAATATTCAAGACATACTCTGGTGAAAAAGGGnnnnnnnnnnnnnnnnnnnnC


annealing, extension, and ligation:

	    H1 promoter						 gRNA Scaffold
-------------------------------------                    ---------------------------->
GGAATCTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CCTTAGAATATTCAAGACATACTCTGGTGAAAAAGGGnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTT
                                     --------------------
                                            target


Sequence verify with M13R:

Final sequence (+ strand)

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAG
GCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGT
GGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAAT
GTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTTTTTCCCNNNNNNNNNN
NNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC
TTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT


Final sequence (- strand)

AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAAC
TTGCTATTTCTAGCTCTAAAACnnnnnnnnnnnnnnnnnnnnGGGAAAAAGTGGTCTCAT
ACAGAACTTATAAGATTCCCAAATCCAAAGACATTTCACGTTTATGGTGATTTCCCAGAA
CACATAGCGACATGCAAATATTGCAGGGCGCCACTCCCCTGTCCCTCACAGCCATCTTCC
TGCCAGGGCGCACGCGCGCTGGGTGTTCCCGCCTAGTGACACTGGGCCCGCGATTCCTTG
GAGCGGGTTGATGACGTCAGCGTTCGAATTCC

T7 promoter vector cloning (pT7gRNA)


 truncated T7 promoter       			gRNA Scaffold
     -------------    --------------------------------------------------------------->
ATCGATAATACGACTCACCTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA
 		 ------
                  AvrII

Identify 23bp CRISPR Targeting sequence in the form GN19NGG:


 5’- GNNNNNNNNNNNNNNNNNNN NGG -3’
 ____________________ ___
      targetsite      PAM

*Note the PAM sequence is not incorporated into the gRNA



Design oligos to insert 20bp target sequence into pT7gRNA via Gibson Assembly:


  5’- GNNNNNNNNNNNNNNNNNNN -3’ 
 ||||||||||||||||||||
 3’- Cnnnnnnnnnnnnnnnnnnn -5’

*N corresponds to N20 target site (of N20NGG);

*n corresponds to complement sequence


Forward oligo; CCATCGATAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNNG

Reverse oligo; AACTTGCTATTTCTAGCTCTAAAACnnnnnnnnnnnnnnnnnnnnC



PCR reaction to anneal and extend the two oligos as below:


CCATCGATAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNNG
                        ||||||||||||||||||||||
                        CnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTT


CCATCGATAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAA
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGTAGCTATTATGCTGAGTGATATCnnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTT
--------------------                         ----------------------
      overlap					    overlap


Digest pT7gRNA with AvrII


				          Avr II
				          ------
AGCAGATTGTACTGAGAGTGCACCATCGATAATACGACTCACCTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGT 
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TCGTCTAACATGACTCTCACGTGGTAGCTATTATGCTGAGTGGATCCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCA


AGCAGATTGTACTGAGAGTGCACCATCGATAATACGACTCAC     CTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC
||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||
TCGTCTAACATGACTCTCACGTGGTAGCTATTATGCTGAGTGGATC     CAAAATCTCGATCTTTATCGTTCAATTTTATTCCG


Gibson Assembly


5'->3 vector resection:

GAGCAGATTGTACTGAGAGTGCACCATCGATAATACGACTCAC                             AATAAGGCTAGTCC
||||||||                                                                ||||||||||||||
AACCCTTA                                     CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGG


5'->3' oligo resection:

                                GNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAA           
			        ||||||||||||||||||||||
        GGTAGCTATTATGCTGAGTGATATCnnnnnnnnnnnnnnnnnnnnC


annealing, extension, and ligation:

    T7 promoter					          gRNA Scaffold
  -----------------                    ---------------------------------------------->
 ATAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC
 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 TATTATGCTGAGTGATATCnnnnnnnnnnnnnnnnnnnCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAG
                   --------------------
                          target


Sequence verify with M13R:

Final sequence (+ strand)

CCATCGATAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA
ATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT
GCGGCCGC


Final sequence (- strand)

GCGGCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAA
CTTGCTATTTCTAGCTCTAAAACnnnnnnnnnnnnnnnnnnnCTATAGTGAGTCGTATT
ATCGATGG